Incidental Mutation 'R1601:Crx'
ID176147
Institutional Source Beutler Lab
Gene Symbol Crx
Ensembl Gene ENSMUSG00000041578
Gene Namecone-rod homeobox
SynonymsCrx1
MMRRC Submission 039638-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R1601 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location15865947-15879968 bp(-) (GRCm38)
Type of Mutationunclassified (245 bp from exon)
DNA Base Change (assembly) T to C at 15867811 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044434] [ENSMUST00000132563] [ENSMUST00000172758] [ENSMUST00000174318]
Predicted Effect probably damaging
Transcript: ENSMUST00000044434
AA Change: D290G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043436
Gene: ENSMUSG00000041578
AA Change: D290G

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
Pfam:TF_Otx 164 250 1.1e-15 PFAM
internal_repeat_1 260 278 1.41e-5 PROSPERO
internal_repeat_1 279 296 1.41e-5 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000132563
SMART Domains Protein: ENSMUSP00000133833
Gene: ENSMUSG00000041578

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
low complexity region 196 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165905
AA Change: D314G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126642
Gene: ENSMUSG00000041578
AA Change: D314G

DomainStartEndE-ValueType
HOX 63 125 2.39e-24 SMART
low complexity region 163 177 N/A INTRINSIC
Pfam:TF_Otx 188 273 1.9e-17 PFAM
internal_repeat_1 284 302 2.45e-5 PROSPERO
internal_repeat_1 303 320 2.45e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000172758
SMART Domains Protein: ENSMUSP00000134463
Gene: ENSMUSG00000041578

DomainStartEndE-ValueType
HOX 39 74 6.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174318
AA Change: D314G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134400
Gene: ENSMUSG00000041578
AA Change: D314G

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
Pfam:TF_Otx 164 250 1.1e-15 PFAM
internal_repeat_1 260 278 1.41e-5 PROSPERO
internal_repeat_1 279 296 1.41e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174358
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a photoreceptor-specific transcription factor which plays a role in the differentiation of photoreceptor cells. This homeodomain protein is necessary for the maintenance of normal cone and rod function. Mutations in this gene are associated with photoreceptor degeneration, Leber congenital amaurosis type III and the autosomal dominant cone-rod dystrophy 2. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a lack of photoreceptor outer segments and rod and cone activity, reduced expression of several photoreceptor- and pineal-specific genes, and altered circadian behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4933416C03Rik T C 10: 116,113,616 S2G probably damaging Het
Adgra2 T C 8: 27,110,018 probably null Het
Adgrb2 T C 4: 129,992,837 S257P probably benign Het
Adgre1 A G 17: 57,441,353 K518E probably benign Het
Anxa7 A T 14: 20,464,615 Y64* probably null Het
Arhgef7 A G 8: 11,782,638 probably null Het
Cdc42bpa T A 1: 180,065,001 Y243* probably null Het
Cdk14 C T 5: 5,135,378 V176M probably damaging Het
Cnbd2 A G 2: 156,333,631 E54G probably damaging Het
Cyp24a1 A G 2: 170,485,691 F511L possibly damaging Het
Ddx11 A G 17: 66,150,385 M810V probably damaging Het
Dock10 T C 1: 80,549,802 T1077A probably benign Het
Dopey1 G A 9: 86,536,250 D2011N probably damaging Het
Ehhadh T A 16: 21,766,408 H241L probably benign Het
Enah A T 1: 181,919,620 L523* probably null Het
Fabp3 T C 4: 130,308,848 L24P probably benign Het
Fat2 A G 11: 55,282,010 S2626P probably benign Het
Fbxo4 A G 15: 3,968,965 M337T possibly damaging Het
Gas6 G T 8: 13,465,786 T662N probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hrh4 G A 18: 13,015,898 V106I possibly damaging Het
Ido2 G T 8: 24,576,189 H20Q possibly damaging Het
Ikbkap T A 4: 56,774,756 K740* probably null Het
Itga10 G T 3: 96,653,658 R613L possibly damaging Het
Itsn2 T C 12: 4,658,452 S836P probably benign Het
Kcng3 A T 17: 83,588,339 C233S probably damaging Het
Kdm3b A G 18: 34,808,731 Q625R probably damaging Het
Kidins220 A G 12: 25,005,088 S553G probably benign Het
Krt82 A T 15: 101,545,153 I266N probably damaging Het
Lama5 A T 2: 180,197,745 L736Q probably damaging Het
Lnx2 A G 5: 147,033,519 C138R probably damaging Het
Mcm5 T C 8: 75,119,354 C397R possibly damaging Het
Me1 A C 9: 86,678,012 Y52D probably damaging Het
Muc4 C A 16: 32,755,501 probably benign Het
Myo18b G T 5: 112,871,498 Q638K possibly damaging Het
Ncapd2 A G 6: 125,185,772 L170P probably damaging Het
Neb A T 2: 52,287,252 L1359* probably null Het
Nomo1 C A 7: 46,046,955 S299Y probably damaging Het
Olfr1359 C A 13: 21,703,226 T75K probably damaging Het
Olfr1509 A C 14: 52,450,442 T10P probably benign Het
Olfr322 A T 11: 58,666,077 R173W probably damaging Het
Olfr57 A T 10: 79,035,504 Y236F possibly damaging Het
Onecut1 A T 9: 74,862,691 H132L probably benign Het
Paqr3 A G 5: 97,111,389 Y19H probably benign Het
Prdx5 T C 19: 6,907,558 H140R possibly damaging Het
Prox1 T C 1: 190,161,006 D414G probably damaging Het
Ptprh T G 7: 4,552,638 E774A probably damaging Het
Rnpepl1 A T 1: 92,917,222 D412V possibly damaging Het
Sars2 C T 7: 28,748,971 T259M probably benign Het
Sbf2 T C 7: 110,340,076 probably null Het
Sbno2 C T 10: 80,060,492 R898H probably damaging Het
Smox C A 2: 131,520,174 T172N probably damaging Het
Tdrd9 C T 12: 112,023,253 R341* probably null Het
Thrap3 C G 4: 126,180,101 G284A probably damaging Het
Tmtc4 A G 14: 122,944,826 V271A probably benign Het
Trank1 A G 9: 111,373,477 T1637A probably damaging Het
Tspan5 T A 3: 138,896,835 I166N probably damaging Het
Vps13b T C 15: 35,642,436 V1398A probably benign Het
Xbp1 C T 11: 5,521,975 R34W probably damaging Het
Other mutations in Crx
AlleleSourceChrCoordTypePredicted EffectPPH Score
Typhlotic UTSW 7 15868107 nonsense probably null
R0437:Crx UTSW 7 15871146 nonsense probably null
R0729:Crx UTSW 7 15871133 splice site probably benign
R1898:Crx UTSW 7 15868223 missense probably damaging 1.00
R1933:Crx UTSW 7 15868376 nonsense probably null
R1988:Crx UTSW 7 15869347 missense possibly damaging 0.95
R5272:Crx UTSW 7 15868285 missense probably damaging 0.99
R5326:Crx UTSW 7 15868337 missense probably damaging 1.00
R5542:Crx UTSW 7 15868337 missense probably damaging 1.00
R6134:Crx UTSW 7 15868107 nonsense probably null
R7313:Crx UTSW 7 15867932 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACCTGAGGCTGAATGGTTCAC -3'
(R):5'- AGCCCCTTATGCCATGACCTATGC -3'

Sequencing Primer
(F):5'- CACAGCCTTTGGCAGGATTG -3'
(R):5'- CCAAGTTCCTATTTCAGTGGGTTG -3'
Posted On2014-04-24