Mutagenetix > Incidental Mutations

Incidental Mutation 'R1601:Sbf2'

176150

Institutional Source

Beutler Lab

Gene Symbol

Sbf2

Ensembl Gene

ENSMUSG00000038371

Gene Name

SET binding factor 2

Synonyms

mMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2

MMRRC Submission

039638-MU

Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene?

Possibly non essential (E-score: 0.372) question?

Stock #

R1601 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110308013-110614922 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 110340076 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000126217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000164759] [ENSMUST00000166020] [ENSMUST00000166020]

Predicted Effect

probably null
Transcript: ENSMUST00000033058

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000033058

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164525

SMART Domains

Protein: ENSMUSP00000128340
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
Pfam:Myotub-related	28	217	1.5e-21	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000164599

SMART Domains

Protein: ENSMUSP00000131927
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	1	339	1.9e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000164599

SMART Domains

Protein: ENSMUSP00000131927
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	1	339	1.9e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000164759

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000164759

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165992

Predicted Effect

probably null
Transcript: ENSMUST00000166020

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000166020

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169740

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.1%
20x: 88.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032F04Rik	G	A	3: 68,870,213	S169N	probably benign	Het
4933416C03Rik	T	C	10: 116,113,616	S2G	probably damaging	Het
Adgra2	T	C	8: 27,110,018		probably null	Het
Adgrb2	T	C	4: 129,992,837	S257P	probably benign	Het
Adgre1	A	G	17: 57,441,353	K518E	probably benign	Het
Anxa7	A	T	14: 20,464,615	Y64*	probably null	Het
Arhgef7	A	G	8: 11,782,638		probably null	Het
Cdc42bpa	T	A	1: 180,065,001	Y243*	probably null	Het
Cdk14	C	T	5: 5,135,378	V176M	probably damaging	Het
Cnbd2	A	G	2: 156,333,631	E54G	probably damaging	Het
Crx	T	C	7: 15,867,811		probably null	Het
Cyp24a1	A	G	2: 170,485,691	F511L	possibly damaging	Het
Ddx11	A	G	17: 66,150,385	M810V	probably damaging	Het
Dock10	T	C	1: 80,549,802	T1077A	probably benign	Het
Dopey1	G	A	9: 86,536,250	D2011N	probably damaging	Het
Ehhadh	T	A	16: 21,766,408	H241L	probably benign	Het
Enah	A	T	1: 181,919,620	L523*	probably null	Het
Fabp3	T	C	4: 130,308,848	L24P	probably benign	Het
Fat2	A	G	11: 55,282,010	S2626P	probably benign	Het
Fbxo4	A	G	15: 3,968,965	M337T	possibly damaging	Het
Gas6	G	T	8: 13,465,786	T662N	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Hrh4	G	A	18: 13,015,898	V106I	possibly damaging	Het
Ido2	G	T	8: 24,576,189	H20Q	possibly damaging	Het
Ikbkap	T	A	4: 56,774,756	K740*	probably null	Het
Itga10	G	T	3: 96,653,658	R613L	possibly damaging	Het
Itsn2	T	C	12: 4,658,452	S836P	probably benign	Het
Kcng3	A	T	17: 83,588,339	C233S	probably damaging	Het
Kdm3b	A	G	18: 34,808,731	Q625R	probably damaging	Het
Kidins220	A	G	12: 25,005,088	S553G	probably benign	Het
Krt82	A	T	15: 101,545,153	I266N	probably damaging	Het
Lama5	A	T	2: 180,197,745	L736Q	probably damaging	Het
Lnx2	A	G	5: 147,033,519	C138R	probably damaging	Het
Mcm5	T	C	8: 75,119,354	C397R	possibly damaging	Het
Me1	A	C	9: 86,678,012	Y52D	probably damaging	Het
Muc4	C	A	16: 32,755,501		probably benign	Het
Myo18b	G	T	5: 112,871,498	Q638K	possibly damaging	Het
Ncapd2	A	G	6: 125,185,772	L170P	probably damaging	Het
Neb	A	T	2: 52,287,252	L1359*	probably null	Het
Nomo1	C	A	7: 46,046,955	S299Y	probably damaging	Het
Olfr1359	C	A	13: 21,703,226	T75K	probably damaging	Het
Olfr1509	A	C	14: 52,450,442	T10P	probably benign	Het
Olfr322	A	T	11: 58,666,077	R173W	probably damaging	Het
Olfr57	A	T	10: 79,035,504	Y236F	possibly damaging	Het
Onecut1	A	T	9: 74,862,691	H132L	probably benign	Het
Paqr3	A	G	5: 97,111,389	Y19H	probably benign	Het
Prdx5	T	C	19: 6,907,558	H140R	possibly damaging	Het
Prox1	T	C	1: 190,161,006	D414G	probably damaging	Het
Ptprh	T	G	7: 4,552,638	E774A	probably damaging	Het
Rnpepl1	A	T	1: 92,917,222	D412V	possibly damaging	Het
Sars2	C	T	7: 28,748,971	T259M	probably benign	Het
Sbno2	C	T	10: 80,060,492	R898H	probably damaging	Het
Smox	C	A	2: 131,520,174	T172N	probably damaging	Het
Tdrd9	C	T	12: 112,023,253	R341*	probably null	Het
Thrap3	C	G	4: 126,180,101	G284A	probably damaging	Het
Tmtc4	A	G	14: 122,944,826	V271A	probably benign	Het
Trank1	A	G	9: 111,373,477	T1637A	probably damaging	Het
Tspan5	T	A	3: 138,896,835	I166N	probably damaging	Het
Vps13b	T	C	15: 35,642,436	V1398A	probably benign	Het
Xbp1	C	T	11: 5,521,975	R34W	probably damaging	Het

Other mutations in Sbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sbf2	APN	7	110375832	splice site	probably benign
IGL01089:Sbf2	APN	7	110348962	missense	probably damaging	1.00
IGL01144:Sbf2	APN	7	110329903	missense	probably damaging	1.00
IGL01652:Sbf2	APN	7	110447120	missense	probably damaging	1.00
IGL01950:Sbf2	APN	7	110365825	missense	probably benign	0.00
IGL02027:Sbf2	APN	7	110461141	missense	probably damaging	1.00
IGL02244:Sbf2	APN	7	110560295	missense	probably damaging	1.00
IGL02376:Sbf2	APN	7	110462956	missense	probably damaging	0.99
IGL03405:Sbf2	APN	7	110462932	missense	probably damaging	0.98
N/A - 535:Sbf2	UTSW	7	110312752	missense	probably benign
R0084:Sbf2	UTSW	7	110442366	missense	possibly damaging	0.95
R0092:Sbf2	UTSW	7	110320806	splice site	probably benign
R0121:Sbf2	UTSW	7	110489219	critical splice donor site	probably null
R0464:Sbf2	UTSW	7	110464576	splice site	probably benign
R0505:Sbf2	UTSW	7	110399343	missense	probably damaging	1.00
R0531:Sbf2	UTSW	7	110367323	splice site	probably benign
R0554:Sbf2	UTSW	7	110428287	missense	probably damaging	1.00
R0617:Sbf2	UTSW	7	110330683	frame shift	probably null
R0619:Sbf2	UTSW	7	110310262	missense	possibly damaging	0.87
R0799:Sbf2	UTSW	7	110341355	missense	possibly damaging	0.58
R0898:Sbf2	UTSW	7	110371652	missense	possibly damaging	0.59
R1077:Sbf2	UTSW	7	110367172	splice site	probably benign
R1167:Sbf2	UTSW	7	110364549	missense	probably damaging	1.00
R1169:Sbf2	UTSW	7	110310184	missense	probably benign	0.04
R1424:Sbf2	UTSW	7	110315026	missense	probably damaging	1.00
R1536:Sbf2	UTSW	7	110378043	missense	probably damaging	1.00
R1558:Sbf2	UTSW	7	110428346	missense	probably damaging	1.00
R1762:Sbf2	UTSW	7	110312758	missense	probably benign
R1771:Sbf2	UTSW	7	110461146	nonsense	probably null
R1989:Sbf2	UTSW	7	110348923	missense	possibly damaging	0.94
R2109:Sbf2	UTSW	7	110461212	missense	probably damaging	1.00
R2126:Sbf2	UTSW	7	110560295	missense	probably damaging	1.00
R2444:Sbf2	UTSW	7	110330698	missense	probably benign	0.31
R3765:Sbf2	UTSW	7	110375581	missense	probably damaging	1.00
R3808:Sbf2	UTSW	7	110489280	makesense	probably null
R3895:Sbf2	UTSW	7	110447091	missense	probably damaging	0.99
R3978:Sbf2	UTSW	7	110329885	missense	probably benign	0.00
R4056:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4057:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4111:Sbf2	UTSW	7	110428242	missense	probably damaging	1.00
R4569:Sbf2	UTSW	7	110348853	critical splice donor site	probably null
R4670:Sbf2	UTSW	7	110335399	missense	probably damaging	1.00
R4763:Sbf2	UTSW	7	110420917	missense	probably damaging	1.00
R4792:Sbf2	UTSW	7	110351610	missense	probably damaging	0.98
R4811:Sbf2	UTSW	7	110372535	missense	probably damaging	1.00
R4822:Sbf2	UTSW	7	110377939	intron	probably benign
R5110:Sbf2	UTSW	7	110364657	missense	probably benign	0.10
R5143:Sbf2	UTSW	7	110422540	nonsense	probably null
R5443:Sbf2	UTSW	7	110377928	intron	probably benign
R5457:Sbf2	UTSW	7	110312830	missense	probably benign
R5641:Sbf2	UTSW	7	110438901	missense	probably damaging	1.00
R5915:Sbf2	UTSW	7	110378096	nonsense	probably null
R5948:Sbf2	UTSW	7	110489285	missense	probably damaging	1.00
R5977:Sbf2	UTSW	7	110377986	missense	probably benign	0.00
R6052:Sbf2	UTSW	7	110441534	missense	probably damaging	1.00
R6142:Sbf2	UTSW	7	110348975	missense	probably damaging	1.00
R6327:Sbf2	UTSW	7	110441552	missense	probably damaging	1.00
R6356:Sbf2	UTSW	7	110372623	missense	probably damaging	1.00
R6450:Sbf2	UTSW	7	110462863	missense	probably damaging	1.00
R6587:Sbf2	UTSW	7	110440975	missense	probably damaging	1.00
R6696:Sbf2	UTSW	7	110560298	missense	probably benign	0.04
R6986:Sbf2	UTSW	7	110330615	missense	probably damaging	0.99
R7147:Sbf2	UTSW	7	110447061	missense	probably benign	0.01
R7358:Sbf2	UTSW	7	110399348	missense	possibly damaging	0.95
R7414:Sbf2	UTSW	7	110314064	missense	possibly damaging	0.89
R7418:Sbf2	UTSW	7	110365821	missense	probably damaging	1.00
R7423:Sbf2	UTSW	7	110438848	missense	possibly damaging	0.48
R7425:Sbf2	UTSW	7	110375777	nonsense	probably null
R7431:Sbf2	UTSW	7	110351750	missense	probably damaging	1.00
R7497:Sbf2	UTSW	7	110614716	nonsense	probably null
R7556:Sbf2	UTSW	7	110314053	missense	probably benign	0.20
R7604:Sbf2	UTSW	7	110378067	missense	possibly damaging	0.95
R7707:Sbf2	UTSW	7	110330713	critical splice acceptor site	probably null
R7746:Sbf2	UTSW	7	110441426	missense	probably benign	0.01
R7812:Sbf2	UTSW	7	110449963	missense	possibly damaging	0.84
R7849:Sbf2	UTSW	7	110372510	missense	probably damaging	1.00
R8026:Sbf2	UTSW	7	110335387	missense	probably damaging	1.00
R8048:Sbf2	UTSW	7	110315082	missense	probably benign	0.21
R8305:Sbf2	UTSW	7	110371618	missense	possibly damaging	0.79
R8337:Sbf2	UTSW	7	110441462	missense	probably benign
RF005:Sbf2	UTSW	7	110317008	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATTCATAAGCTGCCTTTGGCTTTTC -3'
(R):5'- TGCAGCACACACTCTGCTTGTC -3'

Sequencing Primer
(F):5'- TTCTAAGCGAGAGAAAAAGCTTACC -3'
(R):5'- ACACACTCTGCTTGTCTCTCAG -3'

Posted On

2014-04-24