Incidental Mutation 'R1587:Mfge8'
ID177568
Institutional Source Beutler Lab
Gene Symbol Mfge8
Ensembl Gene ENSMUSG00000030605
Gene Namemilk fat globule-EGF factor 8 protein
SynonymsMFG-E8, Mfgm, EGF/factor VIII, lactadherin, SED1
MMRRC Submission 039624-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R1587 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79133768-79149060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79134765 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 344 (I344F)
Ref Sequence ENSEMBL: ENSMUSP00000103032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032825] [ENSMUST00000032827] [ENSMUST00000107409] [ENSMUST00000205563] [ENSMUST00000205782] [ENSMUST00000206092]
Predicted Effect probably damaging
Transcript: ENSMUST00000032825
AA Change: I381F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032825
Gene: ENSMUSG00000030605
AA Change: I381F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 27 61 2.43e-4 SMART
EGF 67 108 1.41e-5 SMART
low complexity region 123 138 N/A INTRINSIC
FA58C 147 303 1.94e-43 SMART
FA58C 307 463 1.24e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032827
SMART Domains Protein: ENSMUSP00000032827
Gene: ENSMUSG00000030606

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IGv 65 148 3.28e-8 SMART
LINK 164 261 1.78e-46 SMART
LINK 265 357 3.14e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107409
AA Change: I344F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103032
Gene: ENSMUSG00000030605
AA Change: I344F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 27 61 2.43e-4 SMART
EGF 67 108 1.41e-5 SMART
FA58C 110 266 3.68e-44 SMART
FA58C 270 426 1.24e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205494
Predicted Effect probably benign
Transcript: ENSMUST00000205563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205649
Predicted Effect probably benign
Transcript: ENSMUST00000205782
Predicted Effect probably benign
Transcript: ENSMUST00000206092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206338
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to form multiple protein products. The major encoded protein product, lactadherin, is a membrane glycoprotein that promotes phagocytosis of apoptotic cells. This protein has also been implicated in wound healing, autoimmune disease, and cancer. Lactadherin can be further processed to form a smaller cleavage product, medin, which comprises the major protein component of aortic medial amyloid (AMA). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility associated with impaired zona pellucida binding. Fertility is unaffected in female mutant mice. Splenomegaly occurs with age and defects occur in phagocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in Mfge8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Mfge8 APN 7 79136782 missense probably damaging 1.00
IGL01751:Mfge8 APN 7 79136655 critical splice donor site probably null
IGL02023:Mfge8 APN 7 79145237 intron probably benign
IGL02112:Mfge8 APN 7 79143340 missense probably benign
IGL02669:Mfge8 APN 7 79145681 missense probably benign 0.36
IGL02978:Mfge8 APN 7 79141710 missense probably damaging 1.00
IGL02978:Mfge8 APN 7 79141728 missense possibly damaging 0.92
R1657:Mfge8 UTSW 7 79141773 missense probably benign
R1716:Mfge8 UTSW 7 79142443 missense probably damaging 1.00
R4766:Mfge8 UTSW 7 79134525 missense probably damaging 1.00
R5100:Mfge8 UTSW 7 79143300 missense probably benign 0.13
R6932:Mfge8 UTSW 7 79143301 missense probably benign
R7044:Mfge8 UTSW 7 79142520 missense probably benign 0.25
Z1177:Mfge8 UTSW 7 79145737 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTATCCCAGGAATTGTAGCCGGAC -3'
(R):5'- GCACTTCACCGAGCTTTACCGT -3'

Sequencing Primer
(F):5'- ATTGTAGCCGGACAGACAC -3'
(R):5'- ccctcccccacaaatcac -3'
Posted On2014-04-24