Incidental Mutation 'R7044:Mfge8'
ID547210
Institutional Source Beutler Lab
Gene Symbol Mfge8
Ensembl Gene ENSMUSG00000030605
Gene Namemilk fat globule-EGF factor 8 protein
SynonymsMFG-E8, Mfgm, EGF/factor VIII, lactadherin, SED1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R7044 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79133768-79149060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79142520 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 219 (V219A)
Ref Sequence ENSEMBL: ENSMUSP00000032825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032825] [ENSMUST00000107409] [ENSMUST00000205563]
PDB Structure
NMR Structure of the Mouse MFG-E8 C2 Domain [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000032825
AA Change: V219A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032825
Gene: ENSMUSG00000030605
AA Change: V219A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 27 61 2.43e-4 SMART
EGF 67 108 1.41e-5 SMART
low complexity region 123 138 N/A INTRINSIC
FA58C 147 303 1.94e-43 SMART
FA58C 307 463 1.24e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107409
AA Change: V182A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103032
Gene: ENSMUSG00000030605
AA Change: V182A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 27 61 2.43e-4 SMART
EGF 67 108 1.41e-5 SMART
FA58C 110 266 3.68e-44 SMART
FA58C 270 426 1.24e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205563
Meta Mutation Damage Score 0.7592 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to form multiple protein products. The major encoded protein product, lactadherin, is a membrane glycoprotein that promotes phagocytosis of apoptotic cells. This protein has also been implicated in wound healing, autoimmune disease, and cancer. Lactadherin can be further processed to form a smaller cleavage product, medin, which comprises the major protein component of aortic medial amyloid (AMA). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility associated with impaired zona pellucida binding. Fertility is unaffected in female mutant mice. Splenomegaly occurs with age and defects occur in phagocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,612,280 D1169N possibly damaging Het
Ankrd6 T A 4: 32,815,260 Q448L possibly damaging Het
Appl1 A G 14: 26,928,677 S513P possibly damaging Het
Cdhr2 A T 13: 54,733,321 K1066* probably null Het
Ckap5 T C 2: 91,577,601 I824T probably benign Het
Ctbp2 T C 7: 133,015,102 R35G possibly damaging Het
Dcdc2c T C 12: 28,470,494 probably benign Het
Eya1 T A 1: 14,231,410 probably null Het
Fam105a A G 15: 27,657,235 probably benign Het
Fam207a T C 10: 77,514,392 D35G possibly damaging Het
Fat4 G C 3: 39,010,810 A4972P probably benign Het
Fat4 C T 3: 39,010,811 A4972V probably benign Het
Fbxl8 T A 8: 105,267,015 M1K probably null Het
Glyat T C 19: 12,650,265 S75P probably benign Het
Gm3543 T A 14: 41,980,066 I154F probably damaging Het
Gm4565 T A 7: 22,583,370 M8L probably benign Het
Gpr179 T C 11: 97,349,790 Q269R probably benign Het
Hfe2 C A 3: 96,527,474 H176Q possibly damaging Het
Ikzf2 T C 1: 69,538,901 H483R possibly damaging Het
Il25 G A 14: 54,933,158 A63T probably benign Het
Krt27 T A 11: 99,346,814 N366I probably benign Het
Nrbp1 T C 5: 31,249,946 V373A probably damaging Het
Olfr1186 A G 2: 88,526,486 N301S probably benign Het
Pcdh20 A G 14: 88,469,171 I231T probably damaging Het
Pfkp A G 13: 6,581,567 W151R probably damaging Het
Pikfyve T C 1: 65,246,854 I1084T probably benign Het
Poteg T C 8: 27,449,895 C27R probably damaging Het
Ptprz1 G A 6: 23,044,346 V1266M probably damaging Het
Rpa1 T C 11: 75,312,802 D358G probably damaging Het
Snapc4 A G 2: 26,369,953 S495P probably damaging Het
Surf6 A G 2: 26,899,356 I123T probably damaging Het
Sybu A T 15: 44,677,695 S324T possibly damaging Het
Trim3 A T 7: 105,618,214 S319R probably damaging Het
Trmt11 A G 10: 30,590,934 F72L probably benign Het
Tsks C T 7: 44,943,792 R61W probably damaging Het
Ube2k T C 5: 65,581,429 V36A possibly damaging Het
Ube3a T C 7: 59,288,413 V688A probably damaging Het
Vegfc A G 8: 54,157,045 K79E possibly damaging Het
Vmn1r77 G A 7: 12,041,834 R179Q probably benign Het
Vmn2r97 T A 17: 18,914,367 F16I probably benign Het
Zfp451 A T 1: 33,802,167 probably benign Het
Zfp600 C T 4: 146,195,322 Q187* probably null Het
Other mutations in Mfge8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Mfge8 APN 7 79136782 missense probably damaging 1.00
IGL01751:Mfge8 APN 7 79136655 critical splice donor site probably null
IGL02023:Mfge8 APN 7 79145237 intron probably benign
IGL02112:Mfge8 APN 7 79143340 missense probably benign
IGL02669:Mfge8 APN 7 79145681 missense probably benign 0.36
IGL02978:Mfge8 APN 7 79141710 missense probably damaging 1.00
IGL02978:Mfge8 APN 7 79141728 missense possibly damaging 0.92
R1587:Mfge8 UTSW 7 79134765 missense probably damaging 1.00
R1657:Mfge8 UTSW 7 79141773 missense probably benign
R1716:Mfge8 UTSW 7 79142443 missense probably damaging 1.00
R4766:Mfge8 UTSW 7 79134525 missense probably damaging 1.00
R5100:Mfge8 UTSW 7 79143300 missense probably benign 0.13
R6932:Mfge8 UTSW 7 79143301 missense probably benign
Z1177:Mfge8 UTSW 7 79145737 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGGGAGATTCACCCCAAC -3'
(R):5'- AACTTGGGCTTTTCAGAGCG -3'

Sequencing Primer
(F):5'- TGCTTCTCAATCAGTGCTAGAC -3'
(R):5'- GCGTAGGCTCCAGAACCTC -3'
Posted On2019-05-13