Mutagenetix > Incidental Mutations

Incidental Mutation 'R1347:Filip1l'

186176

Institutional Source

Beutler Lab

Gene Symbol

Filip1l

Ensembl Gene

ENSMUSG00000043336

Gene Name

filamin A interacting protein 1-like

Synonyms

MMRRC Submission

039412-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1347 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57353093-57573126 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57570987 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 646 (D646G)

Ref Sequence

ENSEMBL: ENSMUSP00000124179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]

Predicted Effect

probably benign
Transcript: ENSMUST00000114371

SMART Domains

Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:CMS1	42	266	7.9e-35	PFAM
Pfam:DEAD	127	234	4e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159414
AA Change: D408G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: D408G

Domain	Start	End	E-Value	Type
coiled coil region	4	345	N/A	INTRINSIC
coiled coil region	371	542	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	868	879	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159816
AA Change: D646G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: D646G

Domain	Start	End	E-Value	Type
Pfam:CortBP2	61	246	1.8e-65	PFAM
low complexity region	271	286	N/A	INTRINSIC
low complexity region	483	495	N/A	INTRINSIC
coiled coil region	609	780	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
low complexity region	1106	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231282

Predicted Effect

probably benign
Transcript: ENSMUST00000232413

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932441B19Rik	C	T	13: 65,035,388	T248I	probably benign	Het
Ak5	G	T	3: 152,533,434	D301E	probably damaging	Het
Arpc1a	G	T	5: 145,097,272	W150L	probably damaging	Het
Foxa1	A	T	12: 57,542,284	H383Q	probably damaging	Het
Fpr-rs6	T	C	17: 20,182,749	T117A	probably benign	Het
Fry	A	T	5: 150,495,818	E905V	probably damaging	Het
Furin	C	T	7: 80,392,184		probably benign	Het
Glyr1	T	C	16: 5,021,339	D338G	probably damaging	Het
Gpd2	A	T	2: 57,357,671	K542M	probably damaging	Het
Itpr3	T	C	17: 27,111,561	F1679L	probably benign	Het
Kif23	A	G	9: 61,927,156	M427T	probably damaging	Het
Kpna1	T	A	16: 36,009,326	I83N	probably benign	Het
Man2a1	T	C	17: 64,712,450	F770L	probably damaging	Het
Mrpl44	T	A	1: 79,777,952	F92I	probably damaging	Het
Myh4	A	G	11: 67,244,741		probably benign	Het
Olfr1458	T	C	19: 13,102,690	I199V	probably benign	Het
Olfr444	A	C	6: 42,955,705	D69A	probably damaging	Het
Rbm15	G	T	3: 107,332,630	R151S	possibly damaging	Het
Rims3	G	A	4: 120,883,125	G90S	probably damaging	Het
Rock2	G	A	12: 16,977,624	C1314Y	possibly damaging	Het
Serpinb6e	C	T	13: 33,841,197	C37Y	possibly damaging	Het
Tbx15	C	A	3: 99,352,111	Q433K	possibly damaging	Het
Vmn1r11	G	A	6: 57,137,978	C209Y	probably benign	Het
Zfhx3	T	C	8: 108,800,698		probably benign	Het
Zim1	C	A	7: 6,677,431	C411F	probably damaging	Het

Other mutations in Filip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Filip1l	APN	16	57572348	nonsense	probably null
IGL01393:Filip1l	APN	16	57572223	missense	probably damaging	1.00
IGL01886:Filip1l	APN	16	57571250	missense	possibly damaging	0.47
IGL02336:Filip1l	APN	16	57571733	intron	probably null
IGL02503:Filip1l	APN	16	57571575	missense	probably benign	0.00
IGL02608:Filip1l	APN	16	57572106	missense	probably benign	0.05
IGL02681:Filip1l	APN	16	57571779	missense	probably benign	0.10
IGL02687:Filip1l	APN	16	57571127	missense	probably benign	0.30
IGL02982:Filip1l	APN	16	57572232	missense	probably damaging	1.00
IGL03062:Filip1l	APN	16	57506804	missense	probably damaging	1.00
R1027:Filip1l	UTSW	16	57569688	missense	probably benign
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1384:Filip1l	UTSW	16	57571289	missense	possibly damaging	0.61
R1655:Filip1l	UTSW	16	57571851	missense	probably damaging	1.00
R1764:Filip1l	UTSW	16	57570038	missense	probably damaging	1.00
R1809:Filip1l	UTSW	16	57506660	missense	probably benign
R1983:Filip1l	UTSW	16	57571274	missense	probably damaging	0.98
R2504:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R2504:Filip1l	UTSW	16	57571047	missense	probably damaging	0.97
R3117:Filip1l	UTSW	16	57506732	missense	probably benign	0.07
R3844:Filip1l	UTSW	16	57572427	missense	probably benign	0.15
R3871:Filip1l	UTSW	16	57513286	missense	probably damaging	0.97
R4231:Filip1l	UTSW	16	57506768	missense	probably benign
R4391:Filip1l	UTSW	16	57570792	nonsense	probably null
R4700:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R4999:Filip1l	UTSW	16	57570415	missense	probably benign	0.01
R5002:Filip1l	UTSW	16	57571103	missense	probably benign	0.01
R5123:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R5294:Filip1l	UTSW	16	57570036	missense	possibly damaging	0.59
R5429:Filip1l	UTSW	16	57570255	missense	probably damaging	0.99
R5811:Filip1l	UTSW	16	57570294	missense	probably damaging	1.00
R6220:Filip1l	UTSW	16	57569989	missense	probably benign	0.31
R6452:Filip1l	UTSW	16	57506800	missense	possibly damaging	0.82
R6678:Filip1l	UTSW	16	57569970	missense	probably benign	0.00
R6700:Filip1l	UTSW	16	57571248	missense	possibly damaging	0.86
R7260:Filip1l	UTSW	16	57570924	missense	probably damaging	1.00
R7327:Filip1l	UTSW	16	57570937	missense	probably damaging	1.00
R7578:Filip1l	UTSW	16	57513282	missense	probably damaging	0.99
Z1088:Filip1l	UTSW	16	57513405	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGCACTCAAGTCCAAAACTGATG -3'
(R):5'- TCTTCCTGGAGCCTCCTAAAGAGC -3'

Sequencing Primer
(F):5'- TTGAAAAACAGGCTTCAGTCAC -3'
(R):5'- TAAAGAGCCACTGCTCGTG -3'

Posted On

2014-05-09