Incidental Mutation 'R5002:Filip1l'
ID390014
Institutional Source Beutler Lab
Gene Symbol Filip1l
Ensembl Gene ENSMUSG00000043336
Gene Namefilamin A interacting protein 1-like
Synonyms
MMRRC Submission 042596-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5002 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location57353093-57573126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57571103 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 447 (Y447H)
Ref Sequence ENSEMBL: ENSMUSP00000124069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]
Predicted Effect probably benign
Transcript: ENSMUST00000114371
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159414
AA Change: Y447H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: Y447H

DomainStartEndE-ValueType
coiled coil region 4 345 N/A INTRINSIC
coiled coil region 371 542 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 868 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159816
AA Change: Y685H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: Y685H

DomainStartEndE-ValueType
Pfam:CortBP2 61 246 1.8e-65 PFAM
low complexity region 271 286 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
coiled coil region 609 780 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
low complexity region 1106 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231282
Predicted Effect probably benign
Transcript: ENSMUST00000232413
Meta Mutation Damage Score 0.0931 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 94% (44/47)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G C 10: 22,067,817 P88R probably damaging Het
Abca8b G A 11: 109,961,797 P736S probably damaging Het
Apbb2 A G 5: 66,313,325 I523T possibly damaging Het
Casq1 T A 1: 172,213,378 D281V possibly damaging Het
Catsperb T C 12: 101,520,554 F447L probably benign Het
Cenpe A T 3: 135,247,081 M1511L probably benign Het
Cep128 T C 12: 91,255,723 probably null Het
Col6a6 T C 9: 105,786,093 T82A probably benign Het
Dna2 A G 10: 62,950,842 D123G probably damaging Het
Ergic2 A G 6: 148,184,158 I281T probably benign Het
Fcgbp T A 7: 28,086,103 probably null Het
Flnb T A 14: 7,945,882 M2429K probably damaging Het
Fn1 T A 1: 71,629,728 Q686L possibly damaging Het
Gm10644 T C 8: 83,933,587 D43G possibly damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm7534 T A 4: 134,196,920 N438I probably benign Het
Gpx6 A G 13: 21,313,688 Y43C probably damaging Het
Hhat A T 1: 192,543,190 F494I probably benign Het
Itga9 C A 9: 118,663,898 S287* probably null Het
Lrrk1 C A 7: 66,332,363 G177W probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Ms4a14 T C 19: 11,304,289 I302V probably benign Het
Nepn A C 10: 52,391,754 M39L probably benign Het
Nfil3 C A 13: 52,968,676 R64L probably damaging Het
Ociad1 T C 5: 73,310,316 V199A possibly damaging Het
Olfr1087 C A 2: 86,690,085 V297L possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Polk A G 13: 96,489,244 Y431H probably damaging Het
Prss33 C T 17: 23,835,358 probably benign Het
Slc12a7 A G 13: 73,763,777 N4S possibly damaging Het
Slc29a4 A T 5: 142,718,746 I348F probably damaging Het
Smarce1 T C 11: 99,225,063 N44S probably damaging Het
Spast C T 17: 74,369,226 Q344* probably null Het
Stk11ip C A 1: 75,532,543 probably benign Het
Tas2r131 T C 6: 132,957,151 I232V probably benign Het
Tesk1 T C 4: 43,444,573 Y126H probably damaging Het
Tmpo A G 10: 91,164,114 V164A possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vwc2l T G 1: 70,729,046 C43G probably damaging Het
Wnk1 G A 6: 119,937,963 T1626I probably benign Het
Other mutations in Filip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Filip1l APN 16 57572348 nonsense probably null
IGL01393:Filip1l APN 16 57572223 missense probably damaging 1.00
IGL01886:Filip1l APN 16 57571250 missense possibly damaging 0.47
IGL02336:Filip1l APN 16 57571733 splice site probably null
IGL02503:Filip1l APN 16 57571575 missense probably benign 0.00
IGL02608:Filip1l APN 16 57572106 missense probably benign 0.05
IGL02681:Filip1l APN 16 57571779 missense probably benign 0.10
IGL02687:Filip1l APN 16 57571127 missense probably benign 0.30
IGL02982:Filip1l APN 16 57572232 missense probably damaging 1.00
IGL03062:Filip1l APN 16 57506804 missense probably damaging 1.00
R1027:Filip1l UTSW 16 57569688 missense probably benign
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1384:Filip1l UTSW 16 57571289 missense possibly damaging 0.61
R1655:Filip1l UTSW 16 57571851 missense probably damaging 1.00
R1764:Filip1l UTSW 16 57570038 missense probably damaging 1.00
R1809:Filip1l UTSW 16 57506660 missense probably benign
R1983:Filip1l UTSW 16 57571274 missense probably damaging 0.98
R2504:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R2504:Filip1l UTSW 16 57571047 missense probably damaging 0.97
R3117:Filip1l UTSW 16 57506732 missense probably benign 0.07
R3844:Filip1l UTSW 16 57572427 missense probably benign 0.15
R3871:Filip1l UTSW 16 57513286 missense probably damaging 0.97
R4231:Filip1l UTSW 16 57506768 missense probably benign
R4391:Filip1l UTSW 16 57570792 nonsense probably null
R4700:Filip1l UTSW 16 57570695 missense probably benign 0.00
R4999:Filip1l UTSW 16 57570415 missense probably benign 0.01
R5123:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R5294:Filip1l UTSW 16 57570036 missense possibly damaging 0.59
R5429:Filip1l UTSW 16 57570255 missense probably damaging 0.99
R5811:Filip1l UTSW 16 57570294 missense probably damaging 1.00
R6220:Filip1l UTSW 16 57569989 missense probably benign 0.31
R6452:Filip1l UTSW 16 57506800 missense possibly damaging 0.82
R6678:Filip1l UTSW 16 57569970 missense probably benign 0.00
R6700:Filip1l UTSW 16 57571248 missense possibly damaging 0.86
R7260:Filip1l UTSW 16 57570924 missense probably damaging 1.00
R7327:Filip1l UTSW 16 57570937 missense probably damaging 1.00
R7578:Filip1l UTSW 16 57513282 missense probably damaging 0.99
R7691:Filip1l UTSW 16 57572433 missense probably benign 0.00
R7950:Filip1l UTSW 16 57569711 missense probably damaging 1.00
R8288:Filip1l UTSW 16 57570554 missense probably damaging 1.00
R8334:Filip1l UTSW 16 57570147 missense probably benign 0.18
R8392:Filip1l UTSW 16 57571353 missense probably damaging 1.00
RF019:Filip1l UTSW 16 57570641 missense probably benign 0.07
Z1088:Filip1l UTSW 16 57513405 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGTAAGTCCACAGCAG -3'
(R):5'- TTGCAGAAGGGAGTGGTCTC -3'

Sequencing Primer
(F):5'- TTAAAGAGCTCTCTCAAGAAGTGG -3'
(R):5'- CTCCTTGGAGGTGACATATTAGGTCC -3'
Posted On2016-06-06