Incidental Mutation 'R1773:H2-M10.6'
ID 196870
Institutional Source Beutler Lab
Gene Symbol H2-M10.6
Ensembl Gene ENSMUSG00000037130
Gene Name histocompatibility 2, M region locus 10.6
Synonyms
MMRRC Submission 039804-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.048) question?
Stock # R1773 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 37123067-37126458 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37123076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 3 (K3R)
Ref Sequence ENSEMBL: ENSMUSP00000039908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041398]
AlphaFold Q85ZW5
Predicted Effect probably benign
Transcript: ENSMUST00000041398
AA Change: K3R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039908
Gene: ENSMUSG00000037130
AA Change: K3R

DomainStartEndE-ValueType
Pfam:MHC_I 24 202 2.2e-47 PFAM
IGc1 221 292 9.31e-22 SMART
transmembrane domain 305 327 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,280,020 (GRCm39) K334E probably damaging Het
Abca12 A G 1: 71,327,755 (GRCm39) Y1442H probably damaging Het
Acot12 A G 13: 91,905,676 (GRCm39) T79A probably benign Het
Adipoq A C 16: 22,973,988 (GRCm39) Q26P unknown Het
Afg2a T C 3: 37,493,334 (GRCm39) F515L probably damaging Het
Akap13 T A 7: 75,333,199 (GRCm39) N1582K possibly damaging Het
Alg9 A G 9: 50,690,396 (GRCm39) T133A probably benign Het
Anks3 T C 16: 4,765,158 (GRCm39) T418A probably benign Het
Ano3 A C 2: 110,591,800 (GRCm39) L37R probably damaging Het
Ano9 A G 7: 140,688,291 (GRCm39) F178L possibly damaging Het
Arhgef12 A G 9: 42,916,838 (GRCm39) probably null Het
Arl16 T A 11: 120,356,589 (GRCm39) I137F possibly damaging Het
Brpf1 T A 6: 113,296,892 (GRCm39) S959T possibly damaging Het
Ccdc27 C T 4: 154,126,222 (GRCm39) R89Q unknown Het
Cd109 A C 9: 78,611,006 (GRCm39) Q1207H probably benign Het
Cd14 A T 18: 36,858,357 (GRCm39) V366D possibly damaging Het
Cep290 G A 10: 100,346,435 (GRCm39) V538I probably benign Het
Cep57 G A 9: 13,727,364 (GRCm39) A202V probably damaging Het
Chl1 T C 6: 103,624,292 (GRCm39) probably null Het
Cmah T G 13: 24,601,282 (GRCm39) F29L probably benign Het
Cracd G T 5: 77,015,052 (GRCm39) A42S possibly damaging Het
Crybg1 A G 10: 43,868,544 (GRCm39) V1378A possibly damaging Het
Cryzl2 A G 1: 157,298,292 (GRCm39) K227R probably benign Het
D130043K22Rik T G 13: 25,066,585 (GRCm39) V794G possibly damaging Het
Ddx4 T A 13: 112,736,436 (GRCm39) T645S probably benign Het
Dhcr7 C T 7: 143,401,195 (GRCm39) R453C possibly damaging Het
Dhx8 T C 11: 101,643,189 (GRCm39) Y754H possibly damaging Het
Dip2b T A 15: 100,091,842 (GRCm39) D860E probably benign Het
Dnah7a T C 1: 53,472,046 (GRCm39) probably null Het
Dst A G 1: 34,330,980 (GRCm39) D6937G probably damaging Het
Dusp1 A G 17: 26,726,081 (GRCm39) I204T probably damaging Het
Dync2h1 T A 9: 7,128,256 (GRCm39) Q1859L probably damaging Het
E4f1 C A 17: 24,665,558 (GRCm39) G328V probably damaging Het
Eml5 T C 12: 98,765,098 (GRCm39) Y1617C probably damaging Het
Espn G T 4: 152,212,686 (GRCm39) P622Q probably damaging Het
Fam184b G A 5: 45,741,676 (GRCm39) P185L possibly damaging Het
Fn1 T A 1: 71,676,542 (GRCm39) D563V probably damaging Het
Gad2 A G 2: 22,580,219 (GRCm39) Y540C probably benign Het
Garin1b T C 6: 29,334,152 (GRCm39) S335P possibly damaging Het
Gdf11 T C 10: 128,727,163 (GRCm39) D131G probably damaging Het
Gm19965 T A 1: 116,748,989 (GRCm39) Y223* probably null Het
Hid1 A G 11: 115,239,336 (GRCm39) Y776H probably damaging Het
Hivep3 A T 4: 119,956,034 (GRCm39) K1450I probably damaging Het
Icam5 T C 9: 20,944,821 (GRCm39) L128P possibly damaging Het
Idnk T C 13: 58,305,526 (GRCm39) V9A probably damaging Het
Il4ra A T 7: 125,166,354 (GRCm39) T33S possibly damaging Het
Ino80 A G 2: 119,248,890 (GRCm39) V990A probably benign Het
Krtap4-9 T C 11: 99,676,396 (GRCm39) probably benign Het
Lrrk2 A G 15: 91,664,184 (GRCm39) I1974V possibly damaging Het
Mcm3ap C T 10: 76,306,994 (GRCm39) A369V probably benign Het
Nek6 A G 2: 38,472,431 (GRCm39) M252V probably benign Het
Nfasc T A 1: 132,538,577 (GRCm39) I443F probably damaging Het
Nme8 T G 13: 19,881,206 (GRCm39) M1L probably damaging Het
Npnt T A 3: 132,610,454 (GRCm39) Q423L possibly damaging Het
Nup133 A T 8: 124,657,722 (GRCm39) C404* probably null Het
Or2b7 T C 13: 21,739,982 (GRCm39) D70G probably damaging Het
Or4c124 A G 2: 89,156,086 (GRCm39) V146A probably benign Het
Or4f14b A G 2: 111,775,204 (GRCm39) V199A possibly damaging Het
Or56a4 T C 7: 104,806,190 (GRCm39) E233G probably benign Het
Or5an1c T C 19: 12,219,023 (GRCm39) M1V probably null Het
Or6c213 A G 10: 129,574,312 (GRCm39) L158S probably damaging Het
Otog T A 7: 45,937,583 (GRCm39) I1764N probably benign Het
Oxa1l A G 14: 54,600,909 (GRCm39) I127M probably benign Het
P4hb C A 11: 120,463,552 (GRCm39) V28F probably damaging Het
Pbld2 C T 10: 62,890,150 (GRCm39) A186V probably benign Het
Pdzph1 G T 17: 59,281,808 (GRCm39) T158K probably damaging Het
Pgm2 T A 5: 64,265,194 (GRCm39) probably null Het
Phip A T 9: 82,758,242 (GRCm39) S1484T probably benign Het
Pikfyve T C 1: 65,231,430 (GRCm39) L100P probably damaging Het
Pikfyve T C 1: 65,285,529 (GRCm39) S923P probably benign Het
Pla2g4e A G 2: 120,075,202 (GRCm39) S63P probably benign Het
Plekhh2 A G 17: 84,906,693 (GRCm39) E1176G probably damaging Het
Prlr T A 15: 10,325,404 (GRCm39) Y192* probably null Het
Pten T A 19: 32,775,472 (GRCm39) C71S probably damaging Het
Rbbp8nl A G 2: 179,922,987 (GRCm39) L202P probably benign Het
Ripor2 T A 13: 24,885,237 (GRCm39) S491T probably benign Het
Robo1 A T 16: 72,801,399 (GRCm39) I1008F probably benign Het
Scg2 T C 1: 79,413,352 (GRCm39) N417S probably benign Het
Scn8a A G 15: 100,937,496 (GRCm39) I1581V probably damaging Het
Slc22a8 T A 19: 8,571,593 (GRCm39) I108N probably damaging Het
Slc9a8 A T 2: 167,313,385 (GRCm39) T416S possibly damaging Het
Spata32 T A 11: 103,099,644 (GRCm39) E287V probably damaging Het
Tgfbrap1 C T 1: 43,114,512 (GRCm39) G196D probably damaging Het
Tgm5 G T 2: 120,908,131 (GRCm39) T15K possibly damaging Het
Tmc1 C T 19: 20,803,865 (GRCm39) probably null Het
Tmem177 T C 1: 119,838,306 (GRCm39) I124M possibly damaging Het
Trim30a A G 7: 104,085,108 (GRCm39) F34S probably damaging Het
Tsn T C 1: 118,232,969 (GRCm39) T112A probably benign Het
Tspyl5 T G 15: 33,686,922 (GRCm39) N341T probably benign Het
Vmn2r108 C T 17: 20,689,335 (GRCm39) C540Y probably damaging Het
Vrtn C T 12: 84,696,998 (GRCm39) R583W probably damaging Het
Wnt1 T C 15: 98,689,638 (GRCm39) S142P probably damaging Het
Wrn A T 8: 33,833,589 (GRCm39) I108N probably damaging Het
Zfhx2 A C 14: 55,310,348 (GRCm39) C733G possibly damaging Het
Zfp219 T C 14: 52,244,563 (GRCm39) T539A probably damaging Het
Zswim8 T A 14: 20,761,598 (GRCm39) M177K probably damaging Het
Other mutations in H2-M10.6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:H2-M10.6 APN 17 37,123,112 (GRCm39) missense probably benign 0.13
IGL01590:H2-M10.6 APN 17 37,123,641 (GRCm39) missense probably benign 0.05
IGL03200:H2-M10.6 APN 17 37,124,908 (GRCm39) missense probably damaging 1.00
IGL03278:H2-M10.6 APN 17 37,124,715 (GRCm39) missense probably damaging 0.99
R0018:H2-M10.6 UTSW 17 37,124,941 (GRCm39) missense probably damaging 1.00
R0144:H2-M10.6 UTSW 17 37,123,133 (GRCm39) missense probably damaging 0.99
R0194:H2-M10.6 UTSW 17 37,124,934 (GRCm39) missense probably damaging 1.00
R1168:H2-M10.6 UTSW 17 37,124,052 (GRCm39) missense probably benign
R1757:H2-M10.6 UTSW 17 37,124,043 (GRCm39) missense probably benign 0.00
R2029:H2-M10.6 UTSW 17 37,124,799 (GRCm39) missense possibly damaging 0.47
R3409:H2-M10.6 UTSW 17 37,124,893 (GRCm39) missense probably damaging 1.00
R3856:H2-M10.6 UTSW 17 37,123,396 (GRCm39) missense probably benign 0.18
R4373:H2-M10.6 UTSW 17 37,123,958 (GRCm39) missense probably damaging 1.00
R4869:H2-M10.6 UTSW 17 37,123,425 (GRCm39) missense probably benign 0.04
R5684:H2-M10.6 UTSW 17 37,124,746 (GRCm39) missense probably damaging 1.00
R6020:H2-M10.6 UTSW 17 37,123,959 (GRCm39) missense probably damaging 1.00
R6180:H2-M10.6 UTSW 17 37,125,178 (GRCm39) missense probably damaging 1.00
R6328:H2-M10.6 UTSW 17 37,124,836 (GRCm39) missense probably damaging 0.96
R8245:H2-M10.6 UTSW 17 37,124,155 (GRCm39) critical splice donor site probably null
R9687:H2-M10.6 UTSW 17 37,125,147 (GRCm39) missense probably benign 0.01
R9705:H2-M10.6 UTSW 17 37,123,642 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGGGAAGCAGTACCCTAGACATC -3'
(R):5'- AGACCCTGACTTTTCAGCCTGGAC -3'

Sequencing Primer
(F):5'- GTACCCTAGACATCCCCCAC -3'
(R):5'- TTTTCAGCCTGGACCCAGAG -3'
Posted On 2014-05-23