Mutagenetix > Incidental Mutation

Incidental Mutation 'R1773:Pikfyve'

196766

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

039804-MU

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1773 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65192271 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 100 (L100P)

Ref Sequence

ENSEMBL: ENSMUSP00000079926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000185263] [ENSMUST00000190058]

AlphaFold

Q9Z1T6

Predicted Effect

probably damaging
Transcript: ENSMUST00000081154
AA Change: L100P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: L100P

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097707
AA Change: L100P

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: L100P

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185263

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185317

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186404

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188799

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189925

Predicted Effect

probably damaging
Transcript: ENSMUST00000190058
AA Change: L100P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949
AA Change: L100P

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190847

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213081

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	A	G	7: 27,580,595	K334E	probably damaging	Het
Abca12	A	G	1: 71,288,596	Y1442H	probably damaging	Het
Acot12	A	G	13: 91,757,557	T79A	probably benign	Het
Adipoq	A	C	16: 23,155,238	Q26P	unknown	Het
Akap13	T	A	7: 75,683,451	N1582K	possibly damaging	Het
Alg9	A	G	9: 50,779,096	T133A	probably benign	Het
Anks3	T	C	16: 4,947,294	T418A	probably benign	Het
Ano3	A	C	2: 110,761,455	L37R	probably damaging	Het
Ano9	A	G	7: 141,108,378	F178L	possibly damaging	Het
Arhgef12	A	G	9: 43,005,542		probably null	Het
Arl16	T	A	11: 120,465,763	I137F	possibly damaging	Het
Brpf1	T	A	6: 113,319,931	S959T	possibly damaging	Het
C530008M17Rik	G	T	5: 76,867,205	A42S	possibly damaging	Het
Ccdc27	C	T	4: 154,041,765	R89Q	unknown	Het
Cd109	A	C	9: 78,703,724	Q1207H	probably benign	Het
Cd14	A	T	18: 36,725,304	V366D	possibly damaging	Het
Cep290	G	A	10: 100,510,573	V538I	probably benign	Het
Cep57	G	A	9: 13,816,068	A202V	probably damaging	Het
Chl1	T	C	6: 103,647,331		probably null	Het
Cmah	T	G	13: 24,417,299	F29L	probably benign	Het
Crybg1	A	G	10: 43,992,548	V1378A	possibly damaging	Het
Cryzl2	A	G	1: 157,470,722	K227R	probably benign	Het
D130043K22Rik	T	G	13: 24,882,602	V794G	possibly damaging	Het
Ddx4	T	A	13: 112,599,902	T645S	probably benign	Het
Dhcr7	C	T	7: 143,847,458	R453C	possibly damaging	Het
Dhx8	T	C	11: 101,752,363	Y754H	possibly damaging	Het
Dip2b	T	A	15: 100,193,961	D860E	probably benign	Het
Dnah7a	T	C	1: 53,432,887		probably null	Het
Dst	A	G	1: 34,291,899	D6937G	probably damaging	Het
Dusp1	A	G	17: 26,507,107	I204T	probably damaging	Het
Dync2h1	T	A	9: 7,128,256	Q1859L	probably damaging	Het
E4f1	C	A	17: 24,446,584	G328V	probably damaging	Het
Eml5	T	C	12: 98,798,839	Y1617C	probably damaging	Het
Espn	G	T	4: 152,128,229	P622Q	probably damaging	Het
Fam184b	G	A	5: 45,584,334	P185L	possibly damaging	Het
Fam71f1	T	C	6: 29,334,153	S335P	possibly damaging	Het
Fn1	T	A	1: 71,637,383	D563V	probably damaging	Het
Gad2	A	G	2: 22,690,207	Y540C	probably benign	Het
Gdf11	T	C	10: 128,891,294	D131G	probably damaging	Het
Gm19965	T	A	1: 116,821,259	Y223*	probably null	Het
H2-M10.6	A	G	17: 36,812,184	K3R	probably benign	Het
Hid1	A	G	11: 115,348,510	Y776H	probably damaging	Het
Hivep3	A	T	4: 120,098,837	K1450I	probably damaging	Het
Icam5	T	C	9: 21,033,525	L128P	possibly damaging	Het
Idnk	T	C	13: 58,157,712	V9A	probably damaging	Het
Il4ra	A	T	7: 125,567,182	T33S	possibly damaging	Het
Ino80	A	G	2: 119,418,409	V990A	probably benign	Het
Krtap4-9	T	C	11: 99,785,570		probably benign	Het
Lrrk2	A	G	15: 91,779,981	I1974V	possibly damaging	Het
Mcm3ap	C	T	10: 76,471,160	A369V	probably benign	Het
Nek6	A	G	2: 38,582,419	M252V	probably benign	Het
Nfasc	T	A	1: 132,610,839	I443F	probably damaging	Het
Nme8	T	G	13: 19,697,036	M1L	probably damaging	Het
Npnt	T	A	3: 132,904,693	Q423L	possibly damaging	Het
Nup133	A	T	8: 123,930,983	C404*	probably null	Het
Olfr1232	A	G	2: 89,325,742	V146A	probably benign	Het
Olfr1307	A	G	2: 111,944,859	V199A	possibly damaging	Het
Olfr1535	T	C	13: 21,555,812	D70G	probably damaging	Het
Olfr262	T	C	19: 12,241,659	M1V	probably null	Het
Olfr684	T	C	7: 105,156,983	E233G	probably benign	Het
Olfr806	A	G	10: 129,738,443	L158S	probably damaging	Het
Otog	T	A	7: 46,288,159	I1764N	probably benign	Het
Oxa1l	A	G	14: 54,363,452	I127M	probably benign	Het
P4hb	C	A	11: 120,572,726	V28F	probably damaging	Het
Pbld2	C	T	10: 63,054,371	A186V	probably benign	Het
Pdzph1	G	T	17: 58,974,813	T158K	probably damaging	Het
Pgm1	T	A	5: 64,107,851		probably null	Het
Phip	A	T	9: 82,876,189	S1484T	probably benign	Het
Pla2g4e	A	G	2: 120,244,721	S63P	probably benign	Het
Plekhh2	A	G	17: 84,599,265	E1176G	probably damaging	Het
Prlr	T	A	15: 10,325,318	Y192*	probably null	Het
Pten	T	A	19: 32,798,072	C71S	probably damaging	Het
Rbbp8nl	A	G	2: 180,281,194	L202P	probably benign	Het
Ripor2	T	A	13: 24,701,254	S491T	probably benign	Het
Robo1	A	T	16: 73,004,511	I1008F	probably benign	Het
Scg2	T	C	1: 79,435,635	N417S	probably benign	Het
Scn8a	A	G	15: 101,039,615	I1581V	probably damaging	Het
Slc22a8	T	A	19: 8,594,229	I108N	probably damaging	Het
Slc9a8	A	T	2: 167,471,465	T416S	possibly damaging	Het
Spata32	T	A	11: 103,208,818	E287V	probably damaging	Het
Spata5	T	C	3: 37,439,185	F515L	probably damaging	Het
Tgfbrap1	C	T	1: 43,075,352	G196D	probably damaging	Het
Tgm5	G	T	2: 121,077,650	T15K	possibly damaging	Het
Tmc1	C	T	19: 20,826,501		probably null	Het
Tmem177	T	C	1: 119,910,576	I124M	possibly damaging	Het
Trim30a	A	G	7: 104,435,901	F34S	probably damaging	Het
Tsn	T	C	1: 118,305,239	T112A	probably benign	Het
Tspyl5	T	G	15: 33,686,776	N341T	probably benign	Het
Vmn2r108	C	T	17: 20,469,073	C540Y	probably damaging	Het
Vrtn	C	T	12: 84,650,224	R583W	probably damaging	Het
Wnt1	T	C	15: 98,791,757	S142P	probably damaging	Het
Wrn	A	T	8: 33,343,561	I108N	probably damaging	Het
Zfhx2	A	C	14: 55,072,891	C733G	possibly damaging	Het
Zfp219	T	C	14: 52,007,106	T539A	probably damaging	Het
Zswim8	T	A	14: 20,711,530	M177K	probably damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9605:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCACCTTGTTGAACTCTGAGCC -3'
(R):5'- ACTAACCTGTGCTCTCCTGAGGATG -3'

Sequencing Primer
(F):5'- GAACTCTGAGCCTTAGTTTTTCAAG -3'
(R):5'- CAAAGTGTTCTCTGCTGAAACC -3'

Posted On

2014-05-23