Incidental Mutation 'R1779:Smc3'
ID197410
Institutional Source Beutler Lab
Gene Symbol Smc3
Ensembl Gene ENSMUSG00000024974
Gene Namestructural maintenance of chromosomes 3
SynonymsSmcD, Mmip1, Bamacan, Cspg6
MMRRC Submission 039810-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1779 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location53600398-53645833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53639369 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 860 (T860S)
Ref Sequence ENSEMBL: ENSMUSP00000025930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025930]
PDB Structure
SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025930
AA Change: T860S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025930
Gene: ENSMUSG00000024974
AA Change: T860S

DomainStartEndE-ValueType
Pfam:AAA_23 5 359 5.4e-10 PFAM
SMC_hinge 530 643 1.85e-23 SMART
low complexity region 684 711 N/A INTRINSIC
Blast:SMC_hinge 712 804 3e-49 BLAST
low complexity region 805 818 N/A INTRINSIC
Blast:SMC_hinge 819 870 3e-23 BLAST
Blast:INB 898 1174 2e-52 BLAST
PDB:1XEW|Y 1032 1212 6e-30 PDB
SCOP:d1e69a_ 1114 1193 2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171083
Meta Mutation Damage Score 0.0786 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the SMC3 subfamily of SMC proteins. The encoded protein occurs in certain cell types as either an intracellular, nuclear protein or a secreted protein. The nuclear form, known as structural maintenance of chromosomes 3, is a component of the multimeric cohesin complex that holds together sister chromatids during mitosis, enabling proper chromosome segregation. Post-translational modification of the encoded protein by the addition of chondroitin sulfate chains gives rise to the secreted proteoglycan bamacan, an abundant basement membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice heterozygous for this allele exhibit partial postnatal lethality, decreased body weight, abnormal craniofacial morphology, and increased T cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,406,514 L476F probably damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
4930432E11Rik A T 7: 29,579,166 noncoding transcript Het
A930011G23Rik A T 5: 99,223,038 probably benign Het
Abcd3 A G 3: 121,781,963 Y217H probably damaging Het
Abraxas1 A T 5: 100,817,956 probably benign Het
Acsbg1 T C 9: 54,616,062 Y427C probably damaging Het
Adam10 T A 9: 70,776,369 probably benign Het
Adam24 G A 8: 40,680,965 V491I possibly damaging Het
Adamts2 T G 11: 50,756,697 V299G probably damaging Het
Adh7 A G 3: 138,223,991 T143A probably damaging Het
Ahcyl1 A G 3: 107,674,103 S81P probably benign Het
Arhgap20 C A 9: 51,849,915 T986K probably benign Het
Atp13a5 A T 16: 29,314,660 I391N possibly damaging Het
Atp6v0a1 C A 11: 101,026,685 A143E probably benign Het
Calcrl A G 2: 84,351,285 I173T probably damaging Het
Casz1 A G 4: 148,932,937 T228A probably benign Het
Cckar A G 5: 53,699,979 I292T probably damaging Het
Cfhr2 T A 1: 139,858,645 probably null Het
Chkb T C 15: 89,429,057 I109V possibly damaging Het
Clec2i T C 6: 128,888,106 probably null Het
Clec4a4 T A 6: 123,023,975 W216R probably damaging Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cp C A 3: 19,957,385 D34E possibly damaging Het
Cse1l T C 2: 166,940,124 probably null Het
Dennd3 T C 15: 73,522,508 probably null Het
Dnah7a A G 1: 53,577,223 V1193A probably benign Het
Eaf2 A G 16: 36,810,470 probably null Het
Ephb2 T C 4: 136,693,825 T405A possibly damaging Het
Fam117a G A 11: 95,378,953 V348M probably damaging Het
Fh1 T C 1: 175,601,424 *167W probably null Het
Fmo9 T A 1: 166,663,299 I486F probably benign Het
Gabbr1 T A 17: 37,054,879 I150N probably damaging Het
Gfpt1 T C 6: 87,077,197 V478A possibly damaging Het
Gm11639 T A 11: 104,720,939 S536T probably benign Het
Gm2663 A T 6: 40,997,960 V59E probably damaging Het
Gm4868 T A 5: 125,848,112 noncoding transcript Het
Heatr4 T A 12: 83,980,160 T108S probably benign Het
Hells G T 19: 38,946,842 A319S probably benign Het
Helz2 A G 2: 181,234,987 V1238A probably benign Het
Helz2 T A 2: 181,238,459 Q488L possibly damaging Het
Hkdc1 A G 10: 62,391,383 F765S probably damaging Het
Hspg2 T A 4: 137,518,509 W938R probably damaging Het
Itpr2 G A 6: 146,158,901 R2473* probably null Het
Kctd1 C T 18: 15,061,782 V595I probably benign Het
Krt7 A G 15: 101,423,409 Y369C probably damaging Het
Krt72 T C 15: 101,780,929 T323A probably benign Het
Krt76 A G 15: 101,892,687 L58P unknown Het
Liph C A 16: 21,968,050 R272L probably benign Het
Lrrc9 A T 12: 72,455,998 K248* probably null Het
Mei4 T A 9: 81,927,142 S93T probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Myo5b A G 18: 74,742,147 M1541V probably benign Het
Napg A G 18: 62,982,691 E66G probably benign Het
Npr3 T C 15: 11,851,486 D406G probably damaging Het
Nr2c2 A G 6: 92,159,243 T355A possibly damaging Het
Olfr1243 A T 2: 89,527,645 I255K probably benign Het
Olfr1461 T C 19: 13,165,040 Y9H probably benign Het
Olfr26 A G 9: 38,855,550 M163V possibly damaging Het
Olfr618 A T 7: 103,597,900 I195F probably damaging Het
Olfr624 A G 7: 103,670,638 I131T probably benign Het
Olfr631 G T 7: 103,929,461 V213L probably benign Het
Olfr71 G A 4: 43,706,041 H176Y probably damaging Het
Orai2 T C 5: 136,150,939 E80G probably damaging Het
Pcdhb14 T A 18: 37,449,482 V547E probably damaging Het
Pcdhb15 T C 18: 37,476,031 I772T possibly damaging Het
Pcnt T C 10: 76,408,796 Q1150R probably damaging Het
Pdcd6 A G 13: 74,305,581 I146T probably damaging Het
Phldb2 T A 16: 45,801,625 D664V probably damaging Het
Pik3ap1 A T 19: 41,332,234 V182E probably damaging Het
Pip4k2a A G 2: 18,847,622 V283A probably benign Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Pnpla6 T C 8: 3,541,404 W1151R probably damaging Het
Ppp1r14c A G 10: 3,366,890 Y75C probably damaging Het
Prl2b1 C T 13: 27,383,469 D224N probably benign Het
Ptgis A G 2: 167,214,858 S270P probably benign Het
Rgs11 C A 17: 26,210,666 A446D probably damaging Het
Rims2 A G 15: 39,681,702 T1531A probably damaging Het
Sbno1 A T 5: 124,388,517 probably benign Het
Scarb2 C G 5: 92,448,557 M409I probably benign Het
Scube3 C T 17: 28,168,379 probably benign Het
Slc44a4 T C 17: 34,921,925 I180T probably damaging Het
Slc9a2 T C 1: 40,742,643 M344T probably damaging Het
Snrpa A G 7: 27,191,749 I99T probably benign Het
Sorcs1 A G 19: 50,175,043 probably benign Het
Sorl1 C T 9: 41,991,482 probably null Het
Suds3 T C 5: 117,105,244 K143R probably benign Het
Supt20 A T 3: 54,714,743 M424L probably benign Het
Tgtp2 T C 11: 49,058,924 M274V probably benign Het
Tmem158 T A 9: 123,259,909 M213L probably benign Het
Tnks C A 8: 34,857,518 R639L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt10c A C 16: 56,034,575 N232K possibly damaging Het
Trpm6 C T 19: 18,856,217 R1587W probably damaging Het
Trrap G A 5: 144,828,590 V2539I probably benign Het
Tsg101 A G 7: 46,907,087 S115P probably benign Het
Ttll13 G T 7: 80,260,508 V800L probably benign Het
Vmn1r57 A G 7: 5,220,577 T34A possibly damaging Het
Vmn2r118 T A 17: 55,611,530 T121S probably benign Het
Wdr35 A G 12: 8,985,772 I238M possibly damaging Het
Wisp2 G A 2: 163,828,986 V138M probably damaging Het
Zfp81 T A 17: 33,335,106 T245S probably benign Het
Zfyve26 G T 12: 79,278,463 P824Q probably damaging Het
Other mutations in Smc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Smc3 APN 19 53629327 missense probably damaging 0.99
IGL01300:Smc3 APN 19 53641852 splice site probably benign
IGL02136:Smc3 APN 19 53635716 missense probably benign 0.02
IGL02216:Smc3 APN 19 53621844 missense probably damaging 1.00
IGL02473:Smc3 APN 19 53636448 missense probably benign 0.06
IGL02797:Smc3 APN 19 53638758 missense probably benign 0.03
IGL02959:Smc3 APN 19 53623557 missense probably benign 0.00
IGL03343:Smc3 APN 19 53613842 missense probably damaging 1.00
R0081:Smc3 UTSW 19 53601562 splice site probably benign
R0940:Smc3 UTSW 19 53640909 missense probably benign 0.10
R1248:Smc3 UTSW 19 53634078 missense probably benign 0.01
R1661:Smc3 UTSW 19 53625065 missense probably benign 0.08
R2046:Smc3 UTSW 19 53639414 missense probably benign 0.00
R2073:Smc3 UTSW 19 53631533 missense probably benign 0.08
R2074:Smc3 UTSW 19 53631533 missense probably benign 0.08
R3077:Smc3 UTSW 19 53627891 missense probably benign 0.16
R4962:Smc3 UTSW 19 53631517 missense probably damaging 0.99
R5684:Smc3 UTSW 19 53640804 missense probably benign 0.00
R6020:Smc3 UTSW 19 53625163 critical splice donor site probably null
R6169:Smc3 UTSW 19 53634086 missense probably benign 0.02
R6221:Smc3 UTSW 19 53641931 missense probably damaging 1.00
R6258:Smc3 UTSW 19 53627731 intron probably null
R6960:Smc3 UTSW 19 53629371 missense probably damaging 0.99
R7048:Smc3 UTSW 19 53629251 missense probably benign 0.01
R7148:Smc3 UTSW 19 53641895 missense possibly damaging 0.93
R7157:Smc3 UTSW 19 53641898 missense probably damaging 1.00
R7805:Smc3 UTSW 19 53640959 missense probably benign 0.26
R8066:Smc3 UTSW 19 53615145 missense probably damaging 1.00
X0026:Smc3 UTSW 19 53625120 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCGCACAACGTTTGCTTCCTT -3'
(R):5'- TGCCCTGAACCCCGACTTCT -3'

Sequencing Primer
(F):5'- GTTTGCTTCCTTGAATGTTCATTTAA -3'
(R):5'- cagagaaaccttgtcttgaaaaac -3'
Posted On2014-05-23