Mutagenetix > Incidental Mutation

Incidental Mutation 'R1779:Liph'

197386

Institutional Source

Beutler Lab

Gene Symbol

Liph

Ensembl Gene

ENSMUSG00000044626

Gene Name

lipase, member H

Synonyms

D16Wsu119e, mPA-PLA1, PLA1B, C130037N08Rik, LPDLR, Lpdlr

MMRRC Submission

039810-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1779 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21953817-21995663 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 21968050 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 272 (R272L)

Ref Sequence

ENSEMBL: ENSMUSP00000156378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060673] [ENSMUST00000074230] [ENSMUST00000231682] [ENSMUST00000231766]

AlphaFold

Q8CIV3

Predicted Effect

probably benign
Transcript: ENSMUST00000060673
AA Change: R274L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000062310
Gene: ENSMUSG00000044626
AA Change: R274L

Domain	Start	End	E-Value	Type
Pfam:Lipase	11	326	6.8e-82	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000074230
AA Change: R244L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000073853
Gene: ENSMUSG00000044626
AA Change: R244L

Domain	Start	End	E-Value	Type
Pfam:Lipase	15	214	1.5e-45	PFAM
Pfam:Abhydrolase_6	73	296	2.3e-6	PFAM
Pfam:Lipase	209	296	1.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000231682

Predicted Effect

probably benign
Transcript: ENSMUST00000231766
AA Change: R272L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232120

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232673

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 93.0%

Validation Efficiency

97% (101/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit wavy vibrissae and wavy and matted coats associated with impaired inner rooth sheath formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	G	3: 124,406,514	L476F	probably damaging	Het
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
4930432E11Rik	A	T	7: 29,579,166		noncoding transcript	Het
A930011G23Rik	A	T	5: 99,223,038		probably benign	Het
Abcd3	A	G	3: 121,781,963	Y217H	probably damaging	Het
Abraxas1	A	T	5: 100,817,956		probably benign	Het
Acsbg1	T	C	9: 54,616,062	Y427C	probably damaging	Het
Adam10	T	A	9: 70,776,369		probably benign	Het
Adam24	G	A	8: 40,680,965	V491I	possibly damaging	Het
Adamts2	T	G	11: 50,756,697	V299G	probably damaging	Het
Adh7	A	G	3: 138,223,991	T143A	probably damaging	Het
Ahcyl1	A	G	3: 107,674,103	S81P	probably benign	Het
Arhgap20	C	A	9: 51,849,915	T986K	probably benign	Het
Atp13a5	A	T	16: 29,314,660	I391N	possibly damaging	Het
Atp6v0a1	C	A	11: 101,026,685	A143E	probably benign	Het
Calcrl	A	G	2: 84,351,285	I173T	probably damaging	Het
Casz1	A	G	4: 148,932,937	T228A	probably benign	Het
Cckar	A	G	5: 53,699,979	I292T	probably damaging	Het
Cfhr2	T	A	1: 139,858,645		probably null	Het
Chkb	T	C	15: 89,429,057	I109V	possibly damaging	Het
Clec2i	T	C	6: 128,888,106		probably null	Het
Clec4a4	T	A	6: 123,023,975	W216R	probably damaging	Het
Cntnap1	A	C	11: 101,186,511	I1000L	probably damaging	Het
Cp	C	A	3: 19,957,385	D34E	possibly damaging	Het
Cse1l	T	C	2: 166,940,124		probably null	Het
Dennd3	T	C	15: 73,522,508		probably null	Het
Dnah7a	A	G	1: 53,577,223	V1193A	probably benign	Het
Eaf2	A	G	16: 36,810,470		probably null	Het
Ephb2	T	C	4: 136,693,825	T405A	possibly damaging	Het
Fam117a	G	A	11: 95,378,953	V348M	probably damaging	Het
Fh1	T	C	1: 175,601,424	*167W	probably null	Het
Fmo9	T	A	1: 166,663,299	I486F	probably benign	Het
Gabbr1	T	A	17: 37,054,879	I150N	probably damaging	Het
Gfpt1	T	C	6: 87,077,197	V478A	possibly damaging	Het
Gm11639	T	A	11: 104,720,939	S536T	probably benign	Het
Gm2663	A	T	6: 40,997,960	V59E	probably damaging	Het
Gm4868	T	A	5: 125,848,112		noncoding transcript	Het
Heatr4	T	A	12: 83,980,160	T108S	probably benign	Het
Hells	G	T	19: 38,946,842	A319S	probably benign	Het
Helz2	A	G	2: 181,234,987	V1238A	probably benign	Het
Helz2	T	A	2: 181,238,459	Q488L	possibly damaging	Het
Hkdc1	A	G	10: 62,391,383	F765S	probably damaging	Het
Hspg2	T	A	4: 137,518,509	W938R	probably damaging	Het
Itpr2	G	A	6: 146,158,901	R2473*	probably null	Het
Kctd1	C	T	18: 15,061,782	V595I	probably benign	Het
Krt7	A	G	15: 101,423,409	Y369C	probably damaging	Het
Krt72	T	C	15: 101,780,929	T323A	probably benign	Het
Krt76	A	G	15: 101,892,687	L58P	unknown	Het
Lrrc9	A	T	12: 72,455,998	K248*	probably null	Het
Mei4	T	A	9: 81,927,142	S93T	probably damaging	Het
Mgll	T	A	6: 88,813,948	Y183*	probably null	Het
Myo5b	A	G	18: 74,742,147	M1541V	probably benign	Het
Napg	A	G	18: 62,982,691	E66G	probably benign	Het
Npr3	T	C	15: 11,851,486	D406G	probably damaging	Het
Nr2c2	A	G	6: 92,159,243	T355A	possibly damaging	Het
Olfr1243	A	T	2: 89,527,645	I255K	probably benign	Het
Olfr1461	T	C	19: 13,165,040	Y9H	probably benign	Het
Olfr26	A	G	9: 38,855,550	M163V	possibly damaging	Het
Olfr618	A	T	7: 103,597,900	I195F	probably damaging	Het
Olfr624	A	G	7: 103,670,638	I131T	probably benign	Het
Olfr631	G	T	7: 103,929,461	V213L	probably benign	Het
Olfr71	G	A	4: 43,706,041	H176Y	probably damaging	Het
Orai2	T	C	5: 136,150,939	E80G	probably damaging	Het
Pcdhb14	T	A	18: 37,449,482	V547E	probably damaging	Het
Pcdhb15	T	C	18: 37,476,031	I772T	possibly damaging	Het
Pcnt	T	C	10: 76,408,796	Q1150R	probably damaging	Het
Pdcd6	A	G	13: 74,305,581	I146T	probably damaging	Het
Phldb2	T	A	16: 45,801,625	D664V	probably damaging	Het
Pik3ap1	A	T	19: 41,332,234	V182E	probably damaging	Het
Pip4k2a	A	G	2: 18,847,622	V283A	probably benign	Het
Pkdrej	A	G	15: 85,821,171	V188A	possibly damaging	Het
Pnpla6	T	C	8: 3,541,404	W1151R	probably damaging	Het
Ppp1r14c	A	G	10: 3,366,890	Y75C	probably damaging	Het
Prl2b1	C	T	13: 27,383,469	D224N	probably benign	Het
Ptgis	A	G	2: 167,214,858	S270P	probably benign	Het
Rgs11	C	A	17: 26,210,666	A446D	probably damaging	Het
Rims2	A	G	15: 39,681,702	T1531A	probably damaging	Het
Sbno1	A	T	5: 124,388,517		probably benign	Het
Scarb2	C	G	5: 92,448,557	M409I	probably benign	Het
Scube3	C	T	17: 28,168,379		probably benign	Het
Slc44a4	T	C	17: 34,921,925	I180T	probably damaging	Het
Slc9a2	T	C	1: 40,742,643	M344T	probably damaging	Het
Smc3	A	T	19: 53,639,369	T860S	probably benign	Het
Snrpa	A	G	7: 27,191,749	I99T	probably benign	Het
Sorcs1	A	G	19: 50,175,043		probably benign	Het
Sorl1	C	T	9: 41,991,482		probably null	Het
Suds3	T	C	5: 117,105,244	K143R	probably benign	Het
Supt20	A	T	3: 54,714,743	M424L	probably benign	Het
Tgtp2	T	C	11: 49,058,924	M274V	probably benign	Het
Tmem158	T	A	9: 123,259,909	M213L	probably benign	Het
Tnks	C	A	8: 34,857,518	R639L	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trmt10c	A	C	16: 56,034,575	N232K	possibly damaging	Het
Trpm6	C	T	19: 18,856,217	R1587W	probably damaging	Het
Trrap	G	A	5: 144,828,590	V2539I	probably benign	Het
Tsg101	A	G	7: 46,907,087	S115P	probably benign	Het
Ttll13	G	T	7: 80,260,508	V800L	probably benign	Het
Vmn1r57	A	G	7: 5,220,577	T34A	possibly damaging	Het
Vmn2r118	T	A	17: 55,611,530	T121S	probably benign	Het
Wdr35	A	G	12: 8,985,772	I238M	possibly damaging	Het
Wisp2	G	A	2: 163,828,986	V138M	probably damaging	Het
Zfp81	T	A	17: 33,335,106	T245S	probably benign	Het
Zfyve26	G	T	12: 79,278,463	P824Q	probably damaging	Het

Other mutations in Liph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Liph	APN	16	21968140	missense	probably damaging	1.00
babyback	UTSW	16	21983957	missense	probably damaging	0.97
PIT4131001:Liph	UTSW	16	21995369	start codon destroyed	probably null	0.59
R0004:Liph	UTSW	16	21984194	nonsense	probably null
R0045:Liph	UTSW	16	21968053	missense	probably damaging	1.00
R0045:Liph	UTSW	16	21968053	missense	probably damaging	1.00
R0348:Liph	UTSW	16	21967980	splice site	probably null
R0689:Liph	UTSW	16	21968068	missense	probably damaging	1.00
R0715:Liph	UTSW	16	21995350	missense	probably benign	0.05
R1104:Liph	UTSW	16	21984148	missense	possibly damaging	0.82
R2323:Liph	UTSW	16	21984004	missense	probably damaging	0.99
R3913:Liph	UTSW	16	21962259	splice site	probably benign
R4402:Liph	UTSW	16	21976250	missense	probably damaging	1.00
R4454:Liph	UTSW	16	21984268	missense	probably benign	0.11
R4672:Liph	UTSW	16	21984056	missense	probably benign	0.14
R4681:Liph	UTSW	16	21984027	missense	probably benign	0.02
R5111:Liph	UTSW	16	21984070	missense	probably damaging	1.00
R5135:Liph	UTSW	16	21956165	nonsense	probably null
R5235:Liph	UTSW	16	21984035	missense	probably damaging	1.00
R5642:Liph	UTSW	16	21965995	missense	possibly damaging	0.61
R5810:Liph	UTSW	16	21968110	missense	probably damaging	1.00
R6188:Liph	UTSW	16	21984268	missense	probably benign	0.11
R6557:Liph	UTSW	16	21983920	missense	possibly damaging	0.60
R6734:Liph	UTSW	16	21983957	missense	probably damaging	0.97
R7011:Liph	UTSW	16	21984097	missense	probably damaging	0.98
R7038:Liph	UTSW	16	21976259	missense	probably damaging	1.00
R7178:Liph	UTSW	16	21976328	missense	probably damaging	1.00
R7185:Liph	UTSW	16	21995339	missense	probably benign	0.00
R7198:Liph	UTSW	16	21966022	missense	probably damaging	1.00
R7775:Liph	UTSW	16	21958914	missense	probably damaging	1.00
R7832:Liph	UTSW	16	21962236	missense	probably benign	0.01
R7993:Liph	UTSW	16	21958812	missense	probably benign	0.03
R8264:Liph	UTSW	16	21983971	missense	possibly damaging	0.94
R8551:Liph	UTSW	16	21981408	missense	probably damaging	1.00
R9311:Liph	UTSW	16	21956163	missense	probably damaging	1.00
R9311:Liph	UTSW	16	21983930	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCTGCTAAGCTGTAATGCCCTATCC -3'
(R):5'- TTCTGGTAAACGCTGCAACTGCTC -3'

Sequencing Primer
(F):5'- caacctaagctaaagagcaagac -3'
(R):5'- GCTGCAACTGCTCTTGGTTC -3'

Posted On

2014-05-23