Incidental Mutation 'R2073:Smc3'
ID227382
Institutional Source Beutler Lab
Gene Symbol Smc3
Ensembl Gene ENSMUSG00000024974
Gene Namestructural maintenance of chromosomes 3
SynonymsSmcD, Mmip1, Bamacan, Cspg6
MMRRC Submission 040078-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2073 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location53600398-53645833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53631533 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 620 (D620G)
Ref Sequence ENSEMBL: ENSMUSP00000025930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025930]
PDB Structure
SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025930
AA Change: D620G

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025930
Gene: ENSMUSG00000024974
AA Change: D620G

DomainStartEndE-ValueType
Pfam:AAA_23 5 359 5.4e-10 PFAM
SMC_hinge 530 643 1.85e-23 SMART
low complexity region 684 711 N/A INTRINSIC
Blast:SMC_hinge 712 804 3e-49 BLAST
low complexity region 805 818 N/A INTRINSIC
Blast:SMC_hinge 819 870 3e-23 BLAST
Blast:INB 898 1174 2e-52 BLAST
PDB:1XEW|Y 1032 1212 6e-30 PDB
SCOP:d1e69a_ 1114 1193 2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157053
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the SMC3 subfamily of SMC proteins. The encoded protein occurs in certain cell types as either an intracellular, nuclear protein or a secreted protein. The nuclear form, known as structural maintenance of chromosomes 3, is a component of the multimeric cohesin complex that holds together sister chromatids during mitosis, enabling proper chromosome segregation. Post-translational modification of the encoded protein by the addition of chondroitin sulfate chains gives rise to the secreted proteoglycan bamacan, an abundant basement membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice heterozygous for this allele exhibit partial postnatal lethality, decreased body weight, abnormal craniofacial morphology, and increased T cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,507,519 probably null Het
2310057M21Rik T C 7: 131,357,513 R153G probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
5730596B20Rik C A 6: 52,178,982 Y9* probably null Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Acot3 A G 12: 84,053,456 H2R possibly damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Adra1b T C 11: 43,835,871 N73S probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ank T C 15: 27,565,022 S270P probably benign Het
Ankle1 G A 8: 71,409,329 R492H possibly damaging Het
Ankub1 G A 3: 57,692,292 H19Y possibly damaging Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Apaf1 G T 10: 91,031,694 S763* probably null Het
Apba3 A G 10: 81,269,294 T134A probably benign Het
Bod1l C T 5: 41,819,189 S1594N probably benign Het
C7 T C 15: 4,990,428 M746V probably benign Het
Cdkn2a T A 4: 89,294,493 I11F possibly damaging Het
Cideb T C 14: 55,755,160 M100V possibly damaging Het
Cntnap5c T C 17: 58,305,552 L862P possibly damaging Het
Coch A T 12: 51,602,689 D261V probably benign Het
Cyp2ab1 A G 16: 20,313,889 F220L possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dgkg A G 16: 22,565,317 F462S probably damaging Het
Dlgap3 C T 4: 127,195,366 H252Y probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Dync1h1 T A 12: 110,614,592 I251N probably damaging Het
Eml5 A G 12: 98,802,446 S1457P probably damaging Het
Fam114a1 T A 5: 64,995,904 probably null Het
Fcho1 A T 8: 71,710,489 L632Q probably damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Gm16223 T C 5: 42,214,599 C111R unknown Het
H2-Q4 T A 17: 35,380,402 S154T possibly damaging Het
Hhat A G 1: 192,727,379 F125L possibly damaging Het
Ier5l T A 2: 30,473,056 D319V probably damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Map2k4 A C 11: 65,693,456 F334V probably damaging Het
Mmp19 G A 10: 128,794,979 R156H probably damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nr4a1 C A 15: 101,274,067 H541N probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1484 A T 19: 13,585,601 Q99L probably damaging Het
Pak6 A C 2: 118,688,851 N17T probably damaging Het
Pcnt T A 10: 76,380,380 T2225S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf21a A G 2: 92,348,036 D357G probably damaging Het
Pih1d3 A G 1: 31,222,996 S20G probably benign Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Plekhd1 A G 12: 80,721,292 N335D probably benign Het
Pole C A 5: 110,325,551 T1737N probably damaging Het
Pramel6 G A 2: 87,508,744 S96N probably damaging Het
Prdm14 A C 1: 13,125,730 Y36D possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rfc1 A T 5: 65,301,939 D225E probably damaging Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Setd6 G A 8: 95,716,788 V60M probably damaging Het
Sgk3 A G 1: 9,891,424 I432V probably benign Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc1a6 T C 10: 78,800,130 V343A possibly damaging Het
Slc43a3 T C 2: 84,944,612 probably null Het
Smg6 C G 11: 74,930,294 P464A probably damaging Het
Sox11 T C 12: 27,342,279 T44A possibly damaging Het
Spata22 A G 11: 73,336,226 R89G possibly damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syne2 A G 12: 76,015,579 D4226G possibly damaging Het
Tecpr2 T C 12: 110,968,429 S1370P possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Trib1 T A 15: 59,654,340 I253N probably damaging Het
Triobp G T 15: 78,973,895 G1232V probably damaging Het
Trpm6 G A 19: 18,876,042 V1809M probably damaging Het
Tsc22d4 A G 5: 137,762,487 K57E possibly damaging Het
Vmn2r109 T A 17: 20,564,712 K15N probably benign Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wnt9a A G 11: 59,331,229 N318D probably damaging Het
Wwp1 A G 4: 19,662,181 V138A possibly damaging Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp715 T A 7: 43,311,120 T16S probably benign Het
Zfp932 A G 5: 110,009,818 T461A possibly damaging Het
Zscan29 A T 2: 121,160,855 C817* probably null Het
Other mutations in Smc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Smc3 APN 19 53629327 missense probably damaging 0.99
IGL01300:Smc3 APN 19 53641852 splice site probably benign
IGL02136:Smc3 APN 19 53635716 missense probably benign 0.02
IGL02216:Smc3 APN 19 53621844 missense probably damaging 1.00
IGL02473:Smc3 APN 19 53636448 missense probably benign 0.06
IGL02797:Smc3 APN 19 53638758 missense probably benign 0.03
IGL02959:Smc3 APN 19 53623557 missense probably benign 0.00
IGL03343:Smc3 APN 19 53613842 missense probably damaging 1.00
Bits UTSW 19 53623218 critical splice donor site probably null
Pieces UTSW 19 53629371 missense probably damaging 0.99
Smithereens UTSW 19 53641931 missense probably damaging 1.00
R0081:Smc3 UTSW 19 53601562 splice site probably benign
R0940:Smc3 UTSW 19 53640909 missense probably benign 0.10
R1248:Smc3 UTSW 19 53634078 missense probably benign 0.01
R1661:Smc3 UTSW 19 53625065 missense probably benign 0.08
R1779:Smc3 UTSW 19 53639369 missense probably benign 0.02
R2046:Smc3 UTSW 19 53639414 missense probably benign 0.00
R2074:Smc3 UTSW 19 53631533 missense probably benign 0.08
R3077:Smc3 UTSW 19 53627891 missense probably benign 0.16
R4962:Smc3 UTSW 19 53631517 missense probably damaging 0.99
R5684:Smc3 UTSW 19 53640804 missense probably benign 0.00
R6020:Smc3 UTSW 19 53625163 critical splice donor site probably null
R6169:Smc3 UTSW 19 53634086 missense probably benign 0.02
R6221:Smc3 UTSW 19 53641931 missense probably damaging 1.00
R6258:Smc3 UTSW 19 53627731 splice site probably null
R6960:Smc3 UTSW 19 53629371 missense probably damaging 0.99
R7048:Smc3 UTSW 19 53629251 missense probably benign 0.01
R7148:Smc3 UTSW 19 53641895 missense possibly damaging 0.93
R7157:Smc3 UTSW 19 53641898 missense probably damaging 1.00
R7805:Smc3 UTSW 19 53640959 missense probably benign 0.26
R7968:Smc3 UTSW 19 53623218 critical splice donor site probably null
R8066:Smc3 UTSW 19 53615145 missense probably damaging 1.00
R8202:Smc3 UTSW 19 53628692 missense possibly damaging 0.94
R8472:Smc3 UTSW 19 53628711 missense probably benign 0.02
X0026:Smc3 UTSW 19 53625120 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCAGAGGCAGACTTTCCATG -3'
(R):5'- TGTATAGCCCAAGTGACAGATTAC -3'

Sequencing Primer
(F):5'- CAGAGGCAGACTTTCCATGTAGTTC -3'
(R):5'- TAGCCCAAGTGACAGATTACATATC -3'
Posted On2014-09-17