Incidental Mutation 'R0083:Sec11a'
ID19757
Institutional Source Beutler Lab
Gene Symbol Sec11a
Ensembl Gene ENSMUSG00000025724
Gene NameSEC11 homolog A, signal peptidase complex subunit
SynonymsSec11l1, 18kDa, sid2895, 1810012E07Rik, Spc18
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R0083 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80904889-80947780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80935039 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 50 (V50A)
Ref Sequence ENSEMBL: ENSMUSP00000112944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026818] [ENSMUST00000117383] [ENSMUST00000119980] [ENSMUST00000120285]
Predicted Effect probably benign
Transcript: ENSMUST00000026818
AA Change: V50A

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026818
Gene: ENSMUSG00000025724
AA Change: V50A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 120 6.2e-13 PFAM
low complexity region 166 176 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117383
AA Change: V50A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113601
Gene: ENSMUSG00000025724
AA Change: V50A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 112 3.1e-12 PFAM
low complexity region 177 187 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119980
AA Change: V50A

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112425
Gene: ENSMUSG00000025724
AA Change: V50A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 120 2.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120285
AA Change: V50A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112944
Gene: ENSMUSG00000025724
AA Change: V50A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Peptidase_S24 51 123 8.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147881
Meta Mutation Damage Score 0.5930 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S26B family. The encoded protein is an 18kDa subunit of the signal peptidase complex and has been linked to cell migration and invasion, gastric cancer and lymph node metastasis. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Sec11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Sec11a APN 7 80935062 missense probably benign 0.21
R0108:Sec11a UTSW 7 80935039 missense probably damaging 1.00
R0661:Sec11a UTSW 7 80935039 missense probably damaging 1.00
R1511:Sec11a UTSW 7 80927734 splice site probably null
R1704:Sec11a UTSW 7 80935100 missense possibly damaging 0.47
R4209:Sec11a UTSW 7 80935042 missense probably damaging 1.00
R5135:Sec11a UTSW 7 80923064 intron probably benign
R6362:Sec11a UTSW 7 80923131 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCCTGATATACCAAACACAGGAATGC -3'
(R):5'- TCATTTCCTTCCCTGGGTGAGGATAG -3'

Sequencing Primer
(F):5'- acacacaaacacactgacac -3'
(R):5'- ATAGTGGTGGATCTGATTTCTTCTC -3'
Posted On2013-04-11