Incidental Mutation 'R1858:Adam23'
ID206279
Institutional Source Beutler Lab
Gene Symbol Adam23
Ensembl Gene ENSMUSG00000025964
Gene Namea disintegrin and metallopeptidase domain 23
SynonymsMDC3
MMRRC Submission 039882-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1858 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63445891-63596276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 63557456 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 566 (I566L)
Ref Sequence ENSEMBL: ENSMUSP00000109742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]
Predicted Effect probably benign
Transcript: ENSMUST00000087374
AA Change: I566L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964
AA Change: I566L

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097717
SMART Domains Protein: ENSMUSP00000095324
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 2 63 6.3e-16 PFAM
Pfam:Reprolysin_5 111 286 2.7e-7 PFAM
Pfam:Reprolysin 112 309 5.7e-57 PFAM
Pfam:Reprolysin_3 136 240 8.7e-7 PFAM
DISIN 324 399 1.4e-30 SMART
ACR 400 541 3.6e-63 SMART
EGF 548 582 9e-2 SMART
transmembrane domain 607 629 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114101
SMART Domains Protein: ENSMUSP00000109736
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 87 247 1.3e-30 PFAM
Pfam:Reprolysin_5 295 470 3.3e-9 PFAM
Pfam:Reprolysin 296 493 8.1e-59 PFAM
Pfam:Reprolysin_3 320 426 1.1e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 686 4.34e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114103
AA Change: I566L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964
AA Change: I566L

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114107
AA Change: I566L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964
AA Change: I566L

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182642
SMART Domains Protein: ENSMUSP00000138362
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 2.2e-30 PFAM
Pfam:Reprolysin_5 295 470 4.6e-9 PFAM
Pfam:Reprolysin 296 493 1.4e-58 PFAM
Pfam:Reprolysin_3 320 426 1.6e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Meta Mutation Damage Score 0.2589 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,974,953 A443E unknown Het
Acacb A T 5: 114,196,709 Y613F probably benign Het
Adar G T 3: 89,739,282 R338L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amotl1 T A 9: 14,575,401 Q399L probably benign Het
Ankrd16 T G 2: 11,778,596 L3R probably benign Het
Arfgap1 G C 2: 180,974,088 G187R probably damaging Het
Arhgap19 A T 19: 41,779,153 V399D probably benign Het
Arl4d A G 11: 101,666,752 T35A probably damaging Het
Atr T A 9: 95,865,097 I144N probably damaging Het
Bptf A G 11: 107,073,301 M1574T probably benign Het
Cacna1h T A 17: 25,380,807 D1684V probably damaging Het
Celsr1 C A 15: 86,032,759 V338F probably damaging Het
Cep164 T C 9: 45,823,640 probably benign Het
Clock C A 5: 76,240,909 G390C possibly damaging Het
Col6a6 A G 9: 105,781,102 F637S probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cul1 A G 6: 47,525,524 probably null Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp3a57 T C 5: 145,381,249 Y347H probably damaging Het
Dgkq G T 5: 108,653,731 T487K probably benign Het
Dmkn T C 7: 30,764,565 V143A probably benign Het
Dmp1 A T 5: 104,207,630 E32V possibly damaging Het
Dsc3 T C 18: 19,965,716 D802G probably damaging Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dusp27 T C 1: 166,100,846 Y399C possibly damaging Het
Dyrk1b A T 7: 28,182,646 probably null Het
Ehd2 T C 7: 15,952,188 T320A probably benign Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif4e1b A G 13: 54,787,278 probably null Het
Fam131b A G 6: 42,318,980 F161L probably damaging Het
Fam171b A T 2: 83,853,381 M81L probably benign Het
Gal3st4 T C 5: 138,270,788 probably null Het
Gdf11 A T 10: 128,886,446 V180E probably damaging Het
Gm4758 A T 16: 36,308,087 I15F probably damaging Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Grin3a T A 4: 49,792,437 Y432F probably benign Het
Hif1a C A 12: 73,944,155 H708N probably benign Het
Hmcn2 G T 2: 31,415,283 probably null Het
Hrasls G A 16: 29,217,718 G36D probably damaging Het
Hs3st6 T A 17: 24,757,999 M151K possibly damaging Het
Hyal2 T A 9: 107,572,338 L431Q probably benign Het
Hyal6 A T 6: 24,740,858 T337S probably benign Het
Igsf5 A T 16: 96,386,629 probably null Het
Kif13a G A 13: 46,864,838 probably benign Het
Krtap19-3 G A 16: 88,877,990 probably benign Het
Lgalsl T C 11: 20,829,420 D75G probably benign Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Ltbp2 T A 12: 84,830,781 K337* probably null Het
Mdn1 C T 4: 32,730,881 H2917Y probably benign Het
Medag A G 5: 149,429,794 I151M probably damaging Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp3 A G 9: 7,451,799 H379R probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Ncoa6 G T 2: 155,421,639 Q292K probably benign Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nlrp4c A G 7: 6,084,656 I763V probably benign Het
Nlrp5 A T 7: 23,418,161 I437F probably damaging Het
Noc2l G A 4: 156,245,270 R435Q probably damaging Het
Nova2 T C 7: 18,958,401 I485T probably damaging Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Nup210l A G 3: 90,154,499 T662A probably damaging Het
Olfr1014 T C 2: 85,777,238 L218P probably damaging Het
Olfr1367 A G 13: 21,347,176 M83V possibly damaging Het
Olfr1368 A T 13: 21,142,394 I221N probably damaging Het
Olfr1370 A T 13: 21,072,471 F277I probably damaging Het
Olfr606 G A 7: 103,452,125 V263I probably benign Het
Olfr612 G A 7: 103,538,652 T194I probably damaging Het
Olfr78 A C 7: 102,742,364 I213S probably damaging Het
Pelp1 G A 11: 70,394,742 P767S probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Plcxd3 T A 15: 4,516,611 probably benign Het
Plekhg1 C A 10: 3,945,917 D436E possibly damaging Het
Ppfibp1 G A 6: 146,990,592 V117I probably benign Het
Prss44 A G 9: 110,814,109 K24R probably benign Het
Ptger1 G T 8: 83,668,478 G195W probably benign Het
Ptgs1 A C 2: 36,242,770 D260A probably benign Het
Ptprd T A 4: 75,947,147 T1198S probably damaging Het
Qsox2 A G 2: 26,214,062 S319P probably damaging Het
Rab35 A G 5: 115,640,088 I38V probably damaging Het
Rapgef4 A G 2: 72,031,064 I33V possibly damaging Het
Rbbp8nl C T 2: 180,282,213 probably benign Het
Riok1 A T 13: 38,058,718 K473* probably null Het
Rtca C T 3: 116,494,115 G288S probably benign Het
Sag A T 1: 87,814,848 D114V probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sec61g A G 11: 16,506,371 probably null Het
Sf3a3 A T 4: 124,729,495 I440F probably damaging Het
Sgta T C 10: 81,048,861 K205E possibly damaging Het
Slc36a4 A G 9: 15,720,710 T61A probably damaging Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Srgap3 A T 6: 112,771,518 L391Q probably damaging Het
Stard13 T C 5: 151,095,438 Y60C probably damaging Het
Syt12 G T 19: 4,447,797 H386N probably damaging Het
Thyn1 T A 9: 27,003,774 M74K probably benign Het
Tmem130 C A 5: 144,752,283 probably null Het
Trim71 A G 9: 114,562,948 V57A possibly damaging Het
Twf1 T C 15: 94,585,547 probably benign Het
Tyro3 T A 2: 119,801,695 I81N possibly damaging Het
Unc13a A T 8: 71,652,399 C740S probably damaging Het
Vmn1r15 A T 6: 57,258,631 K161N probably benign Het
Vmn1r16 A T 6: 57,322,899 I246N probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vmn2r35 T C 7: 7,816,806 Y155C possibly damaging Het
Wif1 T A 10: 121,083,883 probably null Het
Wscd2 G A 5: 113,551,170 R79Q possibly damaging Het
Zan G T 5: 137,405,877 probably benign Het
Zfp9 G T 6: 118,465,060 H214N probably benign Het
Zfp985 A T 4: 147,582,858 Y61F probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Adam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Adam23 APN 1 63570954 missense probably damaging 0.99
IGL00957:Adam23 APN 1 63534311 missense probably benign 0.27
IGL01338:Adam23 APN 1 63551855 missense possibly damaging 0.50
IGL01835:Adam23 APN 1 63543119 missense probably damaging 1.00
IGL01928:Adam23 APN 1 63557446 missense probably damaging 1.00
IGL02563:Adam23 APN 1 63567977 splice site probably benign
IGL02981:Adam23 APN 1 63570953 missense probably damaging 0.99
IGL03037:Adam23 APN 1 63571017 missense possibly damaging 0.63
IGL03176:Adam23 APN 1 63563416 missense probably damaging 1.00
BB007:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
BB017:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
IGL02991:Adam23 UTSW 1 63547819 critical splice donor site probably null
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0125:Adam23 UTSW 1 63534356 missense probably benign 0.00
R0477:Adam23 UTSW 1 63557400 splice site probably benign
R0538:Adam23 UTSW 1 63567844 splice site probably benign
R0617:Adam23 UTSW 1 63543147 missense probably benign 0.06
R1506:Adam23 UTSW 1 63547814 missense probably benign 0.01
R1599:Adam23 UTSW 1 63570933 missense possibly damaging 0.65
R1755:Adam23 UTSW 1 63543170 missense probably damaging 1.00
R1813:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1896:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1943:Adam23 UTSW 1 63477757 critical splice donor site probably null
R2147:Adam23 UTSW 1 63534362 splice site probably null
R2211:Adam23 UTSW 1 63573129 intron probably benign
R2233:Adam23 UTSW 1 63545512 missense probably benign
R2249:Adam23 UTSW 1 63535176 nonsense probably null
R2363:Adam23 UTSW 1 63557491 splice site probably null
R3800:Adam23 UTSW 1 63551774 nonsense probably null
R3974:Adam23 UTSW 1 63547729 nonsense probably null
R3975:Adam23 UTSW 1 63547729 nonsense probably null
R4066:Adam23 UTSW 1 63563425 missense probably damaging 1.00
R4382:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4383:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4384:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4385:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R5385:Adam23 UTSW 1 63551811 missense possibly damaging 0.74
R5435:Adam23 UTSW 1 63546453 missense possibly damaging 0.73
R6465:Adam23 UTSW 1 63566668 missense probably damaging 1.00
R6490:Adam23 UTSW 1 63557454 missense probably damaging 1.00
R6967:Adam23 UTSW 1 63563336 splice site probably null
R7139:Adam23 UTSW 1 63545577 missense probably damaging 1.00
R7584:Adam23 UTSW 1 63545462 missense probably damaging 1.00
R7930:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
R8261:Adam23 UTSW 1 63528798 missense noncoding transcript
R8425:Adam23 UTSW 1 63585377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCTGAGCCTCATTTC -3'
(R):5'- CTGAAGTAATAGTTTGGTAGAGAGC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- AGGTCTATACTCACAGTCTTT -3'
Posted On2014-06-23