Incidental Mutation 'R1869:Bag6'
ID210595
Institutional Source Beutler Lab
Gene Symbol Bag6
Ensembl Gene ENSMUSG00000024392
Gene NameBCL2-associated athanogene 6
SynonymsScythe, G3, D17H6S52E, Bat3, 2410045D21Rik
MMRRC Submission 039891-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1869 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35135178-35147322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35142826 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 541 (V541A)
Ref Sequence ENSEMBL: ENSMUSP00000134628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025250] [ENSMUST00000166426] [ENSMUST00000172571] [ENSMUST00000173491] [ENSMUST00000173535] [ENSMUST00000173550] [ENSMUST00000173952] [ENSMUST00000174281] [ENSMUST00000174478]
Predicted Effect probably benign
Transcript: ENSMUST00000025250
AA Change: V523A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025250
Gene: ENSMUSG00000024392
AA Change: V523A

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 1.7e-44 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 557 625 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
low complexity region 673 721 N/A INTRINSIC
low complexity region 725 747 N/A INTRINSIC
low complexity region 765 780 N/A INTRINSIC
low complexity region 798 808 N/A INTRINSIC
low complexity region 1029 1042 N/A INTRINSIC
low complexity region 1088 1098 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166426
AA Change: V505A
SMART Domains Protein: ENSMUSP00000129324
Gene: ENSMUSG00000024392
AA Change: V505A

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 539 607 N/A INTRINSIC
low complexity region 614 630 N/A INTRINSIC
low complexity region 655 703 N/A INTRINSIC
low complexity region 707 729 N/A INTRINSIC
low complexity region 747 762 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1070 1080 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172571
AA Change: V500A
SMART Domains Protein: ENSMUSP00000134175
Gene: ENSMUSG00000024392
AA Change: V500A

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 252 N/A INTRINSIC
Pfam:DUF3538 254 370 3.5e-53 PFAM
low complexity region 404 415 N/A INTRINSIC
low complexity region 534 602 N/A INTRINSIC
low complexity region 609 625 N/A INTRINSIC
low complexity region 650 698 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 742 757 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172925
Predicted Effect probably benign
Transcript: ENSMUST00000172993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173351
Predicted Effect probably benign
Transcript: ENSMUST00000173491
SMART Domains Protein: ENSMUSP00000134279
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173535
SMART Domains Protein: ENSMUSP00000133822
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 20 29 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
UBQ 58 128 5.62e-22 SMART
low complexity region 137 153 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 261 280 N/A INTRINSIC
low complexity region 287 305 N/A INTRINSIC
Pfam:DUF3538 318 434 1.3e-53 PFAM
low complexity region 468 479 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173550
AA Change: V541A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134628
Gene: ENSMUSG00000024392
AA Change: V541A

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 496 511 N/A INTRINSIC
low complexity region 574 642 N/A INTRINSIC
low complexity region 649 665 N/A INTRINSIC
low complexity region 690 738 N/A INTRINSIC
low complexity region 742 764 N/A INTRINSIC
low complexity region 782 797 N/A INTRINSIC
low complexity region 815 825 N/A INTRINSIC
low complexity region 1046 1059 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173952
SMART Domains Protein: ENSMUSP00000134717
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 20 29 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
UBQ 58 128 5.62e-22 SMART
low complexity region 137 153 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174281
AA Change: V559A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134425
Gene: ENSMUSG00000024392
AA Change: V559A

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 3.6e-53 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
low complexity region 592 660 N/A INTRINSIC
low complexity region 667 683 N/A INTRINSIC
low complexity region 708 756 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 1064 1077 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174478
SMART Domains Protein: ENSMUSP00000138117
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174797
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first characterized as part of a cluster of genes located within the human major histocompatibility complex class III region. This gene encodes a nuclear protein that is cleaved by caspase 3 and is implicated in the control of apoptosis. In addition, the protein forms a complex with E1A binding protein p300 and is required for the acetylation of p53 in response to DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in either embryonic lethality following abnormal brain development or neonatal death associated with severe developmental defects in the lung and kidney. These developmental defects are associated with widespread aberrant apoptosis and proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,890,067 L110P probably damaging Het
6030458C11Rik T C 15: 12,817,907 D168G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abhd11 A G 5: 135,011,617 Y168C probably damaging Het
Actr5 A C 2: 158,638,723 T554P probably damaging Het
Adamts16 A G 13: 70,735,747 L1103P probably damaging Het
Adgrb3 A T 1: 25,826,438 I108K possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Aoc3 T A 11: 101,331,467 Y176* probably null Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Ap4b1 T A 3: 103,820,868 Y399* probably null Het
Arhgef5 A T 6: 43,288,682 I1553F probably damaging Het
Bdp1 A C 13: 100,042,201 V1879G probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Bsnd C T 4: 106,486,636 V158I probably benign Het
Cachd1 C A 4: 100,983,390 H880N probably damaging Het
Ccdc27 T C 4: 154,026,763 probably null Het
Cd74 C T 18: 60,810,412 P190S probably benign Het
Cep68 A T 11: 20,240,217 L265Q probably damaging Het
Cfap70 G A 14: 20,408,610 Q772* probably null Het
CK137956 T A 4: 127,970,534 S101C possibly damaging Het
Clca3a2 G A 3: 144,806,403 T524M probably benign Het
Cxcr6 T C 9: 123,809,957 S15P probably benign Het
Cyfip2 T A 11: 46,224,168 Y904F probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Ddx56 C T 11: 6,263,993 V389M possibly damaging Het
Dmp1 A T 5: 104,212,076 D206V probably damaging Het
Dnah17 A T 11: 118,047,189 C3350* probably null Het
Dpcr1 A G 17: 35,638,413 L98P possibly damaging Het
Dst A T 1: 34,252,832 S877C probably damaging Het
Ermp1 A G 19: 29,646,015 S192P possibly damaging Het
F13b G A 1: 139,510,934 D359N probably benign Het
Fam171a1 A T 2: 3,226,152 Q769L possibly damaging Het
Fap T C 2: 62,528,727 R411G probably damaging Het
Fbn1 A G 2: 125,352,027 V1340A probably benign Het
Fbxw19 T C 9: 109,482,032 I370V probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Frem2 T G 3: 53,535,196 D2640A probably benign Het
Fzd4 T C 7: 89,407,246 V167A probably benign Het
Galnt3 T C 2: 66,097,779 I258V possibly damaging Het
Galr2 T C 11: 116,283,243 V233A possibly damaging Het
Gldc G T 19: 30,139,332 Q407K probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr89 A G 3: 96,875,659 I325T probably benign Het
Grap T A 11: 61,664,189 Y61N possibly damaging Het
Hbs1l G T 10: 21,358,406 probably null Het
Hexb T A 13: 97,191,259 E134D probably benign Het
Hydin T A 8: 110,500,705 V1507D possibly damaging Het
Igkv8-16 C A 6: 70,386,987 G17V probably benign Het
Kdm4a T A 4: 118,138,871 Q987L probably null Het
Krt76 A G 15: 101,889,487 probably null Het
Lap3 T C 5: 45,503,387 S238P probably benign Het
Letm2 T C 8: 25,581,713 D391G probably damaging Het
Lipn A G 19: 34,080,739 T287A possibly damaging Het
Macf1 T C 4: 123,351,128 S466G probably damaging Het
Map3k5 C A 10: 20,132,109 S1220* probably null Het
Map4 T C 9: 110,034,964 V419A probably benign Het
Map4 T A 9: 110,068,928 S754R possibly damaging Het
Mroh9 A G 1: 163,026,513 S773P probably damaging Het
Mtus1 A C 8: 41,076,230 probably null Het
Muc1 C T 3: 89,231,810 P533S probably damaging Het
Muc13 A T 16: 33,804,600 I282F probably damaging Het
Myh14 T A 7: 44,611,643 Q1816L possibly damaging Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfml2b A G 1: 170,669,243 D481G probably damaging Het
Olfr1000 A G 2: 85,608,500 S137P probably benign Het
Olfr1087 T A 2: 86,690,391 I195F probably damaging Het
Olfr309 T A 7: 86,306,667 I149F possibly damaging Het
Olfr703 T G 7: 106,845,094 I161S probably benign Het
Olfr884 T A 9: 38,048,202 probably null Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Pcnt T C 10: 76,379,906 E2347G probably null Het
Phax T A 18: 56,573,104 V22D probably benign Het
Pik3ca T C 3: 32,450,350 F667S probably damaging Het
Pkd1 T C 17: 24,594,931 F4123S probably damaging Het
Pkhd1 A G 1: 20,615,267 probably null Het
Plcb1 G A 2: 135,311,014 R368K probably benign Het
Prrc2a G T 17: 35,153,308 R1739S possibly damaging Het
Psg23 A T 7: 18,614,618 M88K probably benign Het
Pstk T A 7: 131,387,797 Y354N probably damaging Het
Rab39 A G 9: 53,705,931 I62T possibly damaging Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rasgrp1 T C 2: 117,290,347 Y431C probably damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf167 T A 11: 70,650,139 I197N possibly damaging Het
Rtn1 A G 12: 72,308,168 S335P probably damaging Het
Ryr2 G T 13: 11,662,075 R3297S probably damaging Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scgb1b24 T C 7: 33,744,044 Y43H probably damaging Het
Sh3rf3 T A 10: 59,083,513 M484K probably damaging Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc1a7 A G 4: 108,008,364 T350A probably damaging Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slk T C 19: 47,625,452 F916L probably damaging Het
Snap91 T A 9: 86,790,141 probably null Het
Snrpb2 A T 2: 143,065,186 R25S possibly damaging Het
Specc1l T C 10: 75,261,825 Y811H probably damaging Het
Sprr2h A G 3: 92,386,618 probably benign Het
Sult2a5 A T 7: 13,624,120 I26F probably benign Het
Syt13 C T 2: 92,946,103 T245I possibly damaging Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Telo2 T A 17: 25,114,994 D93V probably benign Het
Tet2 A T 3: 133,481,441 probably null Het
Tgm7 A T 2: 121,101,089 C198S probably damaging Het
Ticrr T C 7: 79,679,135 F674S probably damaging Het
Tmem129 C A 5: 33,654,499 C31F probably damaging Het
Tmem132a T A 19: 10,858,688 D826V possibly damaging Het
Tpd52 T C 3: 8,953,802 probably null Het
Trub2 A G 2: 29,777,666 S321P probably benign Het
Ttc29 A G 8: 78,282,385 T295A probably benign Het
Tubb1 G A 2: 174,456,689 S89N probably benign Het
Ubap2 C A 4: 41,233,617 G91V probably damaging Het
Ugt2b35 A G 5: 87,001,288 N133D probably damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn1r220 A C 13: 23,184,287 C80G probably damaging Het
Vmn1r79 A G 7: 12,176,647 E152G probably benign Het
Vmn2r28 T C 7: 5,486,346 Y498C probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Zcchc11 T A 4: 108,529,300 F1122L probably damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zfp972 A G 2: 177,921,687 probably null Het
Other mutations in Bag6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Bag6 APN 17 35144651 missense probably damaging 1.00
IGL00489:Bag6 APN 17 35144651 missense probably damaging 1.00
IGL01613:Bag6 APN 17 35143016 unclassified probably benign
IGL01735:Bag6 APN 17 35145761 unclassified probably benign
IGL02146:Bag6 APN 17 35136215 missense probably damaging 1.00
IGL03092:Bag6 APN 17 35145627 missense probably damaging 1.00
IGL03377:Bag6 APN 17 35144982 missense probably damaging 1.00
R0196:Bag6 UTSW 17 35144263 missense probably damaging 1.00
R0449:Bag6 UTSW 17 35141466 missense probably damaging 1.00
R1228:Bag6 UTSW 17 35145333 missense probably damaging 0.99
R1450:Bag6 UTSW 17 35141958 missense probably benign 0.01
R1686:Bag6 UTSW 17 35144952 missense possibly damaging 0.84
R2034:Bag6 UTSW 17 35144692 missense probably damaging 0.99
R2205:Bag6 UTSW 17 35144607 missense probably damaging 1.00
R2428:Bag6 UTSW 17 35147175 missense probably damaging 1.00
R2987:Bag6 UTSW 17 35145685 nonsense probably null
R4691:Bag6 UTSW 17 35139248 missense probably damaging 1.00
R4705:Bag6 UTSW 17 35142343 missense probably damaging 1.00
R4905:Bag6 UTSW 17 35145186 missense probably damaging 1.00
R5001:Bag6 UTSW 17 35145176 missense probably damaging 1.00
R5168:Bag6 UTSW 17 35144695 missense probably damaging 1.00
R5808:Bag6 UTSW 17 35146322 missense probably damaging 1.00
R6118:Bag6 UTSW 17 35143624 missense probably damaging 0.99
R6212:Bag6 UTSW 17 35140302 missense probably benign 0.17
R6279:Bag6 UTSW 17 35138601 missense probably damaging 1.00
R6300:Bag6 UTSW 17 35138601 missense probably damaging 1.00
R6564:Bag6 UTSW 17 35140371 missense probably damaging 0.98
R6783:Bag6 UTSW 17 35144235 missense possibly damaging 0.94
R6927:Bag6 UTSW 17 35145922 critical splice donor site probably null
R7226:Bag6 UTSW 17 35142945 missense unknown
R7490:Bag6 UTSW 17 35140842 missense unknown
R7499:Bag6 UTSW 17 35144392 missense probably benign 0.29
X0025:Bag6 UTSW 17 35146077 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATCACTCATCAGGCCATGG -3'
(R):5'- AAGAAGTTGCCCCACAAGG -3'

Sequencing Primer
(F):5'- CCATGGTGGCAGCTGTTG -3'
(R):5'- AAGGCCGCTCACCATCTG -3'
Posted On2014-06-30