Incidental Mutation 'R1869:Hbs1l'
ID210562
Institutional Source Beutler Lab
Gene Symbol Hbs1l
Ensembl Gene ENSMUSG00000019977
Gene NameHbs1-like (S. cerevisiae)
Synonyms2810035F15Rik, eRFS
MMRRC Submission 039891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1869 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location21295979-21368898 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) G to T at 21358406 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020153] [ENSMUST00000020153] [ENSMUST00000219915]
Predicted Effect probably null
Transcript: ENSMUST00000020153
SMART Domains Protein: ENSMUSP00000020153
Gene: ENSMUSG00000019977

DomainStartEndE-ValueType
Pfam:HBS1_N 33 125 1e-22 PFAM
low complexity region 142 155 N/A INTRINSIC
Pfam:GTP_EFTU 256 521 1.7e-48 PFAM
Pfam:GTP_EFTU_D3 572 681 9.2e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000020153
SMART Domains Protein: ENSMUSP00000020153
Gene: ENSMUSG00000019977

DomainStartEndE-ValueType
Pfam:HBS1_N 33 125 1e-22 PFAM
low complexity region 142 155 N/A INTRINSIC
Pfam:GTP_EFTU 256 521 1.7e-48 PFAM
Pfam:GTP_EFTU_D3 572 681 9.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218850
Predicted Effect probably null
Transcript: ENSMUST00000219915
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding elongation factor family. It is expressed in multiple tissues with the highest expression in heart and skeletal muscle. The intergenic region of this gene and the MYB gene has been identified to be a quantitative trait locus (QTL) controlling fetal hemoglobin level, and this region influnces erythrocyte, platelet, and monocyte counts as well as erythrocyte volume and hemoglobin content. DNA polymorphisms at this region associate with fetal hemoglobin levels and pain crises in sickle cell disease. A single nucleotide polymorphism in exon 1 of this gene is significantly associated with severity in beta-thalassemia/Hemoglobin E. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,890,067 L110P probably damaging Het
6030458C11Rik T C 15: 12,817,907 D168G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abhd11 A G 5: 135,011,617 Y168C probably damaging Het
Actr5 A C 2: 158,638,723 T554P probably damaging Het
Adamts16 A G 13: 70,735,747 L1103P probably damaging Het
Adgrb3 A T 1: 25,826,438 I108K possibly damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Aoc3 T A 11: 101,331,467 Y176* probably null Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Ap4b1 T A 3: 103,820,868 Y399* probably null Het
Arhgef5 A T 6: 43,288,682 I1553F probably damaging Het
Bag6 T C 17: 35,142,826 V541A probably benign Het
Bdp1 A C 13: 100,042,201 V1879G probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Bsnd C T 4: 106,486,636 V158I probably benign Het
Cachd1 C A 4: 100,983,390 H880N probably damaging Het
Ccdc27 T C 4: 154,026,763 probably null Het
Cd74 C T 18: 60,810,412 P190S probably benign Het
Cep68 A T 11: 20,240,217 L265Q probably damaging Het
Cfap70 G A 14: 20,408,610 Q772* probably null Het
CK137956 T A 4: 127,970,534 S101C possibly damaging Het
Clca3a2 G A 3: 144,806,403 T524M probably benign Het
Cxcr6 T C 9: 123,809,957 S15P probably benign Het
Cyfip2 T A 11: 46,224,168 Y904F probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Ddx56 C T 11: 6,263,993 V389M possibly damaging Het
Dmp1 A T 5: 104,212,076 D206V probably damaging Het
Dnah17 A T 11: 118,047,189 C3350* probably null Het
Dpcr1 A G 17: 35,638,413 L98P possibly damaging Het
Dst A T 1: 34,252,832 S877C probably damaging Het
Ermp1 A G 19: 29,646,015 S192P possibly damaging Het
F13b G A 1: 139,510,934 D359N probably benign Het
Fam171a1 A T 2: 3,226,152 Q769L possibly damaging Het
Fap T C 2: 62,528,727 R411G probably damaging Het
Fbn1 A G 2: 125,352,027 V1340A probably benign Het
Fbxw19 T C 9: 109,482,032 I370V probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Frem2 T G 3: 53,535,196 D2640A probably benign Het
Fzd4 T C 7: 89,407,246 V167A probably benign Het
Galnt3 T C 2: 66,097,779 I258V possibly damaging Het
Galr2 T C 11: 116,283,243 V233A possibly damaging Het
Gldc G T 19: 30,139,332 Q407K probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr89 A G 3: 96,875,659 I325T probably benign Het
Grap T A 11: 61,664,189 Y61N possibly damaging Het
Hexb T A 13: 97,191,259 E134D probably benign Het
Hydin T A 8: 110,500,705 V1507D possibly damaging Het
Igkv8-16 C A 6: 70,386,987 G17V probably benign Het
Kdm4a T A 4: 118,138,871 Q987L probably null Het
Krt76 A G 15: 101,889,487 probably null Het
Lap3 T C 5: 45,503,387 S238P probably benign Het
Letm2 T C 8: 25,581,713 D391G probably damaging Het
Lipn A G 19: 34,080,739 T287A possibly damaging Het
Macf1 T C 4: 123,351,128 S466G probably damaging Het
Map3k5 C A 10: 20,132,109 S1220* probably null Het
Map4 T C 9: 110,034,964 V419A probably benign Het
Map4 T A 9: 110,068,928 S754R possibly damaging Het
Mroh9 A G 1: 163,026,513 S773P probably damaging Het
Mtus1 A C 8: 41,076,230 probably null Het
Muc1 C T 3: 89,231,810 P533S probably damaging Het
Muc13 A T 16: 33,804,600 I282F probably damaging Het
Myh14 T A 7: 44,611,643 Q1816L possibly damaging Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfml2b A G 1: 170,669,243 D481G probably damaging Het
Olfr1000 A G 2: 85,608,500 S137P probably benign Het
Olfr1087 T A 2: 86,690,391 I195F probably damaging Het
Olfr309 T A 7: 86,306,667 I149F possibly damaging Het
Olfr703 T G 7: 106,845,094 I161S probably benign Het
Olfr884 T A 9: 38,048,202 probably null Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Pcnt T C 10: 76,379,906 E2347G probably null Het
Phax T A 18: 56,573,104 V22D probably benign Het
Pik3ca T C 3: 32,450,350 F667S probably damaging Het
Pkd1 T C 17: 24,594,931 F4123S probably damaging Het
Pkhd1 A G 1: 20,615,267 probably null Het
Plcb1 G A 2: 135,311,014 R368K probably benign Het
Prrc2a G T 17: 35,153,308 R1739S possibly damaging Het
Psg23 A T 7: 18,614,618 M88K probably benign Het
Pstk T A 7: 131,387,797 Y354N probably damaging Het
Rab39 A G 9: 53,705,931 I62T possibly damaging Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rasgrp1 T C 2: 117,290,347 Y431C probably damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf167 T A 11: 70,650,139 I197N possibly damaging Het
Rtn1 A G 12: 72,308,168 S335P probably damaging Het
Ryr2 G T 13: 11,662,075 R3297S probably damaging Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scgb1b24 T C 7: 33,744,044 Y43H probably damaging Het
Sh3rf3 T A 10: 59,083,513 M484K probably damaging Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc1a7 A G 4: 108,008,364 T350A probably damaging Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slk T C 19: 47,625,452 F916L probably damaging Het
Snap91 T A 9: 86,790,141 probably null Het
Snrpb2 A T 2: 143,065,186 R25S possibly damaging Het
Specc1l T C 10: 75,261,825 Y811H probably damaging Het
Sprr2h A G 3: 92,386,618 probably benign Het
Sult2a5 A T 7: 13,624,120 I26F probably benign Het
Syt13 C T 2: 92,946,103 T245I possibly damaging Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Telo2 T A 17: 25,114,994 D93V probably benign Het
Tet2 A T 3: 133,481,441 probably null Het
Tgm7 A T 2: 121,101,089 C198S probably damaging Het
Ticrr T C 7: 79,679,135 F674S probably damaging Het
Tmem129 C A 5: 33,654,499 C31F probably damaging Het
Tmem132a T A 19: 10,858,688 D826V possibly damaging Het
Tpd52 T C 3: 8,953,802 probably null Het
Trub2 A G 2: 29,777,666 S321P probably benign Het
Ttc29 A G 8: 78,282,385 T295A probably benign Het
Tubb1 G A 2: 174,456,689 S89N probably benign Het
Ubap2 C A 4: 41,233,617 G91V probably damaging Het
Ugt2b35 A G 5: 87,001,288 N133D probably damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn1r220 A C 13: 23,184,287 C80G probably damaging Het
Vmn1r79 A G 7: 12,176,647 E152G probably benign Het
Vmn2r28 T C 7: 5,486,346 Y498C probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Zcchc11 T A 4: 108,529,300 F1122L probably damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zfp972 A G 2: 177,921,687 probably null Het
Other mutations in Hbs1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Hbs1l APN 10 21307756 missense probably benign 0.03
IGL02948:Hbs1l APN 10 21341711 splice site probably benign
R0375:Hbs1l UTSW 10 21342541 missense possibly damaging 0.76
R0465:Hbs1l UTSW 10 21352041 missense probably null 0.85
R0555:Hbs1l UTSW 10 21349323 missense probably benign 0.14
R0909:Hbs1l UTSW 10 21307738 missense probably benign 0.00
R1172:Hbs1l UTSW 10 21304638 missense probably damaging 1.00
R1594:Hbs1l UTSW 10 21352023 missense probably benign 0.00
R1612:Hbs1l UTSW 10 21358835 missense probably damaging 1.00
R2109:Hbs1l UTSW 10 21341932 nonsense probably null
R2369:Hbs1l UTSW 10 21307745 missense probably benign 0.01
R2404:Hbs1l UTSW 10 21296047 start gained probably benign
R4077:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4079:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4534:Hbs1l UTSW 10 21341915 missense possibly damaging 0.74
R4796:Hbs1l UTSW 10 21342506 missense probably damaging 1.00
R4852:Hbs1l UTSW 10 21358388 missense possibly damaging 0.92
R5069:Hbs1l UTSW 10 21354647 missense probably damaging 1.00
R5946:Hbs1l UTSW 10 21341756 missense probably benign
R6232:Hbs1l UTSW 10 21307758 splice site probably null
R6264:Hbs1l UTSW 10 21367757 missense possibly damaging 0.92
R6542:Hbs1l UTSW 10 21304617 missense probably benign 0.11
R6831:Hbs1l UTSW 10 21341868 missense probably benign 0.29
R7295:Hbs1l UTSW 10 21310152 missense probably benign 0.12
R7470:Hbs1l UTSW 10 21358784 missense possibly damaging 0.96
R7652:Hbs1l UTSW 10 21364760 missense probably benign 0.02
R7695:Hbs1l UTSW 10 21299217 missense possibly damaging 0.49
R7909:Hbs1l UTSW 10 21358404 critical splice donor site probably null
R8325:Hbs1l UTSW 10 21307649 missense probably benign 0.02
R8353:Hbs1l UTSW 10 21309279 missense probably benign
R8453:Hbs1l UTSW 10 21309279 missense probably benign
X0018:Hbs1l UTSW 10 21351987 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTTCCACTTGTCACCACTG -3'
(R):5'- TTACAGCTTTCATCCCAAGTACAC -3'

Sequencing Primer
(F):5'- CCATTCAGATTGAAAGCGATGGGC -3'
(R):5'- TTCATCCCAAGTACACACAAAGTCTG -3'
Posted On2014-06-30