Mutagenetix > Incidental Mutation

Incidental Mutation 'R1872:Sort1'

210817

Institutional Source

Beutler Lab

Gene Symbol

Sort1

Ensembl Gene

ENSMUSG00000068747

Gene Name

sortilin 1

Synonyms

sortilin, 2900053A11Rik, Ntsr3, Ntr3, neurotensin receptor 3

MMRRC Submission

039894-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.779) question?

Stock #

R1872 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108284082-108361511 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108340695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 452 (N452S)

Ref Sequence

ENSEMBL: ENSMUSP00000123564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102632] [ENSMUST00000135636]

AlphaFold

Q6PHU5

Predicted Effect

probably benign
Transcript: ENSMUST00000102632
AA Change: N452S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000099692
Gene: ENSMUSG00000068747
AA Change: N452S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	33	47	N/A	INTRINSIC
low complexity region	59	79	N/A	INTRINSIC
VPS10	131	743	N/A	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135636
AA Change: N452S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000123564
Gene: ENSMUSG00000068747
AA Change: N452S

Domain	Start	End	E-Value	Type
VPS10	1	218	2.3e-5	SMART
transmembrane domain	262	284	N/A	INTRINSIC

Meta Mutation Damage Score

0.0598

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

97% (113/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhbit increased protection from age- and injury-related neuron lose. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	C	T	3: 124,556,844	C133Y	unknown	Het
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abce1	A	G	8: 79,690,251	M377T	possibly damaging	Het
Adam25	A	T	8: 40,755,226	R510*	probably null	Het
Adamts12	G	T	15: 11,217,880	E308*	probably null	Het
Adgrg3	C	A	8: 95,033,442	N96K	possibly damaging	Het
Afdn	T	C	17: 13,881,316	V1022A	probably damaging	Het
Akap9	T	C	5: 4,001,406	V1391A	probably damaging	Het
Akip1	A	G	7: 109,711,775	Y174C	probably damaging	Het
Ap3b2	T	C	7: 81,464,150	T830A	unknown	Het
Aph1a	A	G	3: 95,895,564	T159A	probably damaging	Het
Ccdc146	T	C	5: 21,301,290	T718A	probably benign	Het
Cdk5r2	T	C	1: 74,855,822	L242P	probably damaging	Het
Cep97	T	A	16: 55,927,866	N67I	probably damaging	Het
Chic2	A	T	5: 75,011,479	W121R	possibly damaging	Het
Clock	A	G	5: 76,248,462	S147P	possibly damaging	Het
Cntnap5a	T	G	1: 116,089,210	S178A	probably benign	Het
Col11a2	C	A	17: 34,062,555		probably benign	Het
Col6a3	T	A	1: 90,830,214	H6L	probably damaging	Het
Cpne5	T	C	17: 29,204,693	N154D	probably benign	Het
Ctsz	T	G	2: 174,427,976	K273Q	probably benign	Het
Cybrd1	G	A	2: 71,129,760	V101M	probably benign	Het
Cyp2c23	T	A	19: 44,005,551	K459*	probably null	Het
Cyp4a31	A	T	4: 115,574,736	H419L	probably damaging	Het
D930020B18Rik	G	A	10: 121,641,974	V35M	probably damaging	Het
Dnah9	C	T	11: 66,037,490	V2118M	probably benign	Het
Doxl2	A	G	6: 48,975,620	I160V	probably benign	Het
Dtna	T	C	18: 23,597,560		probably null	Het
Ednra	C	T	8: 77,720,396	V18I	possibly damaging	Het
Elac1	T	C	18: 73,742,646	R105G	probably benign	Het
Exoc2	A	G	13: 30,822,661	S844P	probably benign	Het
Fam185a	A	T	5: 21,480,330		probably null	Het
Fam204a	A	G	19: 60,199,449	M233T	possibly damaging	Het
Fat1	C	A	8: 44,953,304	H1031N	probably benign	Het
Fat1	T	A	8: 45,038,349	Y3816N	probably damaging	Het
Fbxo38	C	T	18: 62,517,023	R621Q	probably benign	Het
Fhod3	C	A	18: 25,130,610	R1524S	probably damaging	Het
Fnip1	A	T	11: 54,487,735	R192W	probably damaging	Het
Frem3	T	A	8: 80,612,576	H499Q	probably damaging	Het
Gab2	C	T	7: 97,299,043	T280I	probably damaging	Het
Gdpgp1	A	G	7: 80,238,424	R68G	probably benign	Het
Gm10382	C	T	5: 125,389,560		probably benign	Het
Gm4858	T	A	3: 93,074,422	L249H	probably damaging	Het
Gmps	A	G	3: 64,001,517	H480R	probably benign	Het
Hecw1	G	A	13: 14,280,449	R674*	probably null	Het
Herc2	T	A	7: 56,157,509	F2478L	probably benign	Het
Homer2	C	T	7: 81,636,402	V21M	probably damaging	Het
Ifna9	A	G	4: 88,592,255	M44T	probably damaging	Het
Igfl3	A	G	7: 18,179,896	D57G	possibly damaging	Het
Jcad	T	C	18: 4,673,048	M270T	probably benign	Het
Kdm5b	T	C	1: 134,624,994	L1236P	probably damaging	Het
Kif14	T	A	1: 136,486,358	L724Q	probably damaging	Het
Lhb	T	C	7: 45,421,333	V45A	probably damaging	Het
Lhpp	A	G	7: 132,634,087	N134D	probably benign	Het
Mas1	T	C	17: 12,842,191	Y115C	probably damaging	Het
Mb21d1	T	C	9: 78,433,202	D416G	probably benign	Het
Mgam	A	T	6: 40,661,300	K395*	probably null	Het
Mms22l	A	G	4: 24,598,807	N1134S	probably damaging	Het
Mrc1	A	G	2: 14,325,381		probably null	Het
Mrgprg	G	A	7: 143,764,544	S277L	probably damaging	Het
Mrpl49	G	T	19: 6,056,980	P60T	possibly damaging	Het
Mrps10	G	A	17: 47,372,452	G104D	possibly damaging	Het
Msantd3	A	G	4: 48,552,771	Y120C	probably damaging	Het
N4bp2	C	T	5: 65,794,518		probably benign	Het
Nbea	A	G	3: 55,642,889	V2706A	probably benign	Het
Nfic	T	A	10: 81,420,684	M71L	possibly damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1112	A	G	2: 87,191,878	T64A	possibly damaging	Het
Olfr115	G	T	17: 37,609,912	P280T	probably damaging	Het
Olfr1202	T	A	2: 88,817,936	V255E	probably benign	Het
Olfr1234	A	G	2: 89,362,589	L280P	probably damaging	Het
Pak7	T	C	2: 136,085,588	I655V	possibly damaging	Het
Pip5k1c	A	G	10: 81,306,319	N121S	probably damaging	Het
Plce1	A	T	19: 38,760,077	I1737F	probably damaging	Het
Prrt1	T	C	17: 34,630,951	L113P	probably damaging	Het
Ptprq	T	A	10: 107,643,999	T1137S	probably benign	Het
Recql5	T	C	11: 115,923,309	I223V	probably benign	Het
Reg3g	A	T	6: 78,467,853	Y47*	probably null	Het
Rgs12	T	G	5: 34,965,821	M316R	probably damaging	Het
Ric1	T	C	19: 29,602,668	S1290P	probably benign	Het
Rpl36al	A	G	12: 69,182,923	C72R	probably damaging	Het
Rplp0	T	A	5: 115,563,315	F275L	possibly damaging	Het
Rpp30	G	A	19: 36,087,393	V89I	probably benign	Het
Ryr3	A	G	2: 112,709,137	F3253L	possibly damaging	Het
Serpina3n	A	T	12: 104,408,944	N92Y	probably benign	Het
Setd7	G	T	3: 51,542,831	T58N	probably benign	Het
Sh3tc2	T	A	18: 62,011,883	L1136Q	probably damaging	Het
Slc35b4	G	A	6: 34,158,505	Q291*	probably null	Het
Soga1	A	G	2: 157,040,261	C624R	possibly damaging	Het
Sympk	A	G	7: 19,029,145	I46V	probably benign	Het
Syngr2	T	C	11: 117,812,538	V60A	probably damaging	Het
Syt17	A	T	7: 118,408,118	F318I	probably benign	Het
Tgfb1	T	A	7: 25,692,466	L149M	probably damaging	Het
Ticam1	A	T	17: 56,271,897	M66K	probably benign	Het
Tmem131	G	T	1: 36,807,927	D1363E	probably benign	Het
Tns4	A	C	11: 99,080,100	D261E	probably damaging	Het
Trim30a	T	C	7: 104,429,210	N220D	probably benign	Het
Trmt10a	T	C	3: 138,156,720	L257P	probably damaging	Het
Troap	G	T	15: 99,075,352		probably benign	Het
Ttc6	T	C	12: 57,704,552		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vav1	A	C	17: 57,324,750	K775T	probably damaging	Het
Vmn1r236	A	G	17: 21,287,411	K264E	possibly damaging	Het
Vmn1r84	A	G	7: 12,362,628	V46A	probably benign	Het
Wdr59	A	T	8: 111,459,017	W835R	probably damaging	Het
Zfp513	T	G	5: 31,200,423	K202T	probably damaging	Het
Zfp7	T	G	15: 76,891,777	I673S	probably benign	Het
Zmynd11	A	G	13: 9,698,701	I108T	possibly damaging	Het

Other mutations in Sort1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sort1	APN	3	108356307	missense	probably damaging	0.99
IGL01677:Sort1	APN	3	108344885	missense	probably benign	0.05
IGL02532:Sort1	APN	3	108325720	missense	probably benign	0.44
IGL03354:Sort1	APN	3	108348706	missense	probably benign	0.00
R0266:Sort1	UTSW	3	108344931	missense	probably benign	0.09
R0277:Sort1	UTSW	3	108324592	splice site	probably benign
R0559:Sort1	UTSW	3	108356579	missense	probably damaging	1.00
R0597:Sort1	UTSW	3	108338910	missense	probably damaging	1.00
R0624:Sort1	UTSW	3	108348630	missense	probably damaging	1.00
R1803:Sort1	UTSW	3	108325699	missense	probably damaging	1.00
R1986:Sort1	UTSW	3	108345727	missense	possibly damaging	0.71
R2130:Sort1	UTSW	3	108351686	missense	probably benign
R2131:Sort1	UTSW	3	108351686	missense	probably benign
R2133:Sort1	UTSW	3	108351686	missense	probably benign
R2362:Sort1	UTSW	3	108346665	missense	possibly damaging	0.89
R3436:Sort1	UTSW	3	108337807	missense	probably damaging	1.00
R3548:Sort1	UTSW	3	108337909	missense	possibly damaging	0.83
R3700:Sort1	UTSW	3	108356639	nonsense	probably null
R4496:Sort1	UTSW	3	108310145	missense	probably benign	0.17
R4616:Sort1	UTSW	3	108355541	missense	possibly damaging	0.66
R4632:Sort1	UTSW	3	108346678	missense	probably damaging	1.00
R4749:Sort1	UTSW	3	108356323	nonsense	probably null
R4994:Sort1	UTSW	3	108328069	missense	probably damaging	0.99
R5187:Sort1	UTSW	3	108324676	missense	probably damaging	1.00
R5753:Sort1	UTSW	3	108345774	missense	probably damaging	1.00
R6019:Sort1	UTSW	3	108357233	missense	possibly damaging	0.77
R6262:Sort1	UTSW	3	108310211	missense	probably damaging	1.00
R7369:Sort1	UTSW	3	108351680	missense	probably damaging	1.00
R7484:Sort1	UTSW	3	108338825	missense	probably damaging	1.00
R7512:Sort1	UTSW	3	108326007	splice site	probably null
R8076:Sort1	UTSW	3	108338867	missense	probably damaging	1.00
R8222:Sort1	UTSW	3	108334635	missense	probably benign
R8871:Sort1	UTSW	3	108355571	critical splice donor site	probably null
R8894:Sort1	UTSW	3	108338912	missense	probably damaging	1.00
R9169:Sort1	UTSW	3	108340678	nonsense	probably null
Z1177:Sort1	UTSW	3	108284380	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTAGCTGGCTGACTGAAACC -3'
(R):5'- CTTTAAATAAGACAGGTAAGCCGAC -3'

Sequencing Primer
(F):5'- CACACTGGGCTTACGTTA -3'
(R):5'- GACAGGTAAGCCGACTATGG -3'

Posted On

2014-06-30