Incidental Mutation 'R4749:Sort1'
ID357371
Institutional Source Beutler Lab
Gene Symbol Sort1
Ensembl Gene ENSMUSG00000068747
Gene Namesortilin 1
Synonymssortilin, 2900053A11Rik, Ntsr3, Ntr3, neurotensin receptor 3
MMRRC Submission 041969-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R4749 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108284082-108361511 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 108356323 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 812 (Y812*)
Ref Sequence ENSEMBL: ENSMUSP00000123564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102632] [ENSMUST00000135636]
Predicted Effect probably null
Transcript: ENSMUST00000102632
AA Change: Y779*
SMART Domains Protein: ENSMUSP00000099692
Gene: ENSMUSG00000068747
AA Change: Y779*

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
VPS10 131 743 N/A SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129755
Predicted Effect probably null
Transcript: ENSMUST00000135636
AA Change: Y812*
SMART Domains Protein: ENSMUSP00000123564
Gene: ENSMUSG00000068747
AA Change: Y812*

DomainStartEndE-ValueType
VPS10 1 218 2.3e-5 SMART
transmembrane domain 262 284 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhbit increased protection from age- and injury-related neuron lose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,215,721 D79E probably benign Het
Adgra2 A G 8: 27,114,197 K472E probably damaging Het
Akap9 A G 5: 3,968,737 D1106G probably benign Het
Arhgap35 T C 7: 16,498,626 E1367G possibly damaging Het
Arsi A T 18: 60,917,461 Y472F probably benign Het
Asxl3 A G 18: 22,516,769 D605G probably damaging Het
Atp6v1e2 C T 17: 86,944,707 D88N probably benign Het
BC061237 T A 14: 44,506,012 V169E probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
C530008M17Rik T C 5: 76,858,834 V1014A unknown Het
C9 G A 15: 6,489,830 V383I probably benign Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Ccna2 T C 3: 36,566,242 S421G probably benign Het
Cflar T G 1: 58,740,272 V229G possibly damaging Het
Clcn1 A G 6: 42,290,197 probably null Het
Col14a1 T A 15: 55,452,336 F1342L unknown Het
Colq C T 14: 31,529,515 R313H possibly damaging Het
Coro6 A G 11: 77,469,148 E345G probably damaging Het
Cyb561 A G 11: 105,935,882 F182L probably benign Het
Dap3 A G 3: 88,926,310 S317P probably benign Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dsg4 A G 18: 20,446,831 E31G possibly damaging Het
Dsn1 G A 2: 157,001,740 L147F probably damaging Het
Dysf T C 6: 84,067,008 V277A probably damaging Het
Eprs T A 1: 185,396,130 I569K probably damaging Het
Erg T C 16: 95,361,170 N342S probably damaging Het
Fam114a1 G A 5: 65,009,066 D247N probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Foxn4 T C 5: 114,255,567 D497G probably damaging Het
Fsip2 A G 2: 82,989,285 I5121V probably benign Het
Gcn1l1 T A 5: 115,614,402 D2155E probably benign Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gpr171 A G 3: 59,097,466 V296A probably benign Het
Grid1 T A 14: 35,580,687 S970T possibly damaging Het
Hcn3 A T 3: 89,150,063 probably null Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Hsd3b3 G A 3: 98,742,615 P131S probably damaging Het
Hsp90b1 A G 10: 86,701,808 V211A probably damaging Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Ifi208 T A 1: 173,695,614 D483E possibly damaging Het
Kbtbd6 T A 14: 79,453,287 V474E possibly damaging Het
Kif21b T A 1: 136,144,749 Y64* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Map3k10 T C 7: 27,658,361 D664G possibly damaging Het
Map3k5 C A 10: 20,132,052 S1201Y probably benign Het
Mcm2 T C 6: 88,891,991 E293G possibly damaging Het
Med21 T A 6: 146,650,101 probably null Het
Mettl18 T C 1: 163,996,785 V225A probably benign Het
Mmp10 A T 9: 7,508,168 I432F probably damaging Het
Muc5b T G 7: 141,861,448 Y2710* probably null Het
Neurl4 A T 11: 69,911,068 I1282F probably benign Het
Nipbl A T 15: 8,365,829 H191Q possibly damaging Het
Nktr A G 9: 121,741,693 D167G probably damaging Het
Nrap A G 19: 56,380,237 I249T probably damaging Het
Nsfl1c A G 2: 151,509,606 T297A probably benign Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr1449 C T 19: 12,935,217 H160Y probably benign Het
Olfr20 G A 11: 73,354,496 V248M probably damaging Het
Olfr731 A G 14: 50,238,733 S51P probably damaging Het
Pcnx2 T C 8: 125,887,588 S375G probably damaging Het
Phf2 A T 13: 48,821,709 probably null Het
Piezo1 A T 8: 122,486,939 M1739K possibly damaging Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Pml C T 9: 58,234,652 R299H probably damaging Het
Ppp3cb A T 14: 20,524,062 M236K probably damaging Het
Prkch T A 12: 73,692,960 C203S probably damaging Het
Prob1 C T 18: 35,652,816 R795H possibly damaging Het
Prr22 G C 17: 56,771,274 E142D possibly damaging Het
Prss56 C A 1: 87,185,583 A211E possibly damaging Het
Qser1 A C 2: 104,787,304 S1054R probably benign Het
Rhbdl2 T C 4: 123,826,901 probably null Het
Rhot2 C A 17: 25,844,274 G19V probably damaging Het
Rp1l1 C T 14: 64,029,800 T945M probably damaging Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sharpin T A 15: 76,347,567 D314V probably damaging Het
Slc14a2 A T 18: 78,155,581 L778Q probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc4a11 C A 2: 130,690,867 R222L probably damaging Het
Slc7a10 C T 7: 35,200,762 P502S probably damaging Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Tcp10b G A 17: 13,070,945 probably null Het
Tmem8 T C 17: 26,116,783 F48S probably damaging Het
Tnc T C 4: 63,995,639 D1312G possibly damaging Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Topors A T 4: 40,261,015 S756R unknown Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Ube2o T C 11: 116,541,908 D744G probably benign Het
Vmn1r224 A G 17: 20,419,751 I197V probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Other mutations in Sort1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sort1 APN 3 108356307 missense probably damaging 0.99
IGL01677:Sort1 APN 3 108344885 missense probably benign 0.05
IGL02532:Sort1 APN 3 108325720 missense probably benign 0.44
IGL03354:Sort1 APN 3 108348706 missense probably benign 0.00
R0266:Sort1 UTSW 3 108344931 missense probably benign 0.09
R0277:Sort1 UTSW 3 108324592 splice site probably benign
R0559:Sort1 UTSW 3 108356579 missense probably damaging 1.00
R0597:Sort1 UTSW 3 108338910 missense probably damaging 1.00
R0624:Sort1 UTSW 3 108348630 missense probably damaging 1.00
R1803:Sort1 UTSW 3 108325699 missense probably damaging 1.00
R1872:Sort1 UTSW 3 108340695 missense probably benign 0.01
R1986:Sort1 UTSW 3 108345727 missense possibly damaging 0.71
R2130:Sort1 UTSW 3 108351686 missense probably benign
R2131:Sort1 UTSW 3 108351686 missense probably benign
R2133:Sort1 UTSW 3 108351686 missense probably benign
R2362:Sort1 UTSW 3 108346665 missense possibly damaging 0.89
R3436:Sort1 UTSW 3 108337807 missense probably damaging 1.00
R3548:Sort1 UTSW 3 108337909 missense possibly damaging 0.83
R3700:Sort1 UTSW 3 108356639 nonsense probably null
R4496:Sort1 UTSW 3 108310145 missense probably benign 0.17
R4616:Sort1 UTSW 3 108355541 missense possibly damaging 0.66
R4632:Sort1 UTSW 3 108346678 missense probably damaging 1.00
R4994:Sort1 UTSW 3 108328069 missense probably damaging 0.99
R5187:Sort1 UTSW 3 108324676 missense probably damaging 1.00
R5753:Sort1 UTSW 3 108345774 missense probably damaging 1.00
R6019:Sort1 UTSW 3 108357233 missense possibly damaging 0.77
R6262:Sort1 UTSW 3 108310211 missense probably damaging 1.00
R7369:Sort1 UTSW 3 108351680 missense probably damaging 1.00
R7484:Sort1 UTSW 3 108338825 missense probably damaging 1.00
R7512:Sort1 UTSW 3 108326007 splice site probably null
R8076:Sort1 UTSW 3 108338867 missense probably damaging 1.00
R8222:Sort1 UTSW 3 108334635 missense probably benign
Z1177:Sort1 UTSW 3 108284380 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTTGGACCATATGAGCG -3'
(R):5'- TAGTTCCCGAGCTGAAGAGG -3'

Sequencing Primer
(F):5'- GTTGGACCATATGAGCGCAACC -3'
(R):5'- AGTATGGAATTTCCTCAGTTTTCCAC -3'
Posted On2015-11-11