Incidental Mutation 'R7484:Sort1'
ID579981
Institutional Source Beutler Lab
Gene Symbol Sort1
Ensembl Gene ENSMUSG00000068747
Gene Namesortilin 1
Synonymssortilin, 2900053A11Rik, Ntsr3, Ntr3, neurotensin receptor 3
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R7484 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location108284082-108361511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108338825 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 373 (T373A)
Ref Sequence ENSEMBL: ENSMUSP00000123564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102632] [ENSMUST00000135636]
Predicted Effect probably damaging
Transcript: ENSMUST00000102632
AA Change: T373A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099692
Gene: ENSMUSG00000068747
AA Change: T373A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
VPS10 131 743 N/A SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135636
AA Change: T373A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123564
Gene: ENSMUSG00000068747
AA Change: T373A

DomainStartEndE-ValueType
VPS10 1 218 2.3e-5 SMART
transmembrane domain 262 284 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhbit increased protection from age- and injury-related neuron lose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,218,862 V1285I probably damaging Het
Acly A T 11: 100,495,963 I591N probably damaging Het
Acr T A 15: 89,573,224 V225E probably damaging Het
Actr8 A G 14: 29,992,968 D580G probably damaging Het
Adamts12 C A 15: 11,345,648 Q1592K probably benign Het
AI481877 A T 4: 59,062,286 V924E probably damaging Het
Aire T C 10: 78,042,570 E138G probably damaging Het
Apob C T 12: 8,006,884 Q1789* probably null Het
BC147527 A T 13: 120,308,481 K112N probably damaging Het
Cd300lb A T 11: 114,928,519 W95R probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cenpf A G 1: 189,656,821 S1605P probably damaging Het
Ckap2l A G 2: 129,272,535 V596A possibly damaging Het
Cntn1 T C 15: 92,254,041 W454R probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Csf2rb A G 15: 78,338,899 T104A possibly damaging Het
Cyhr1 A G 15: 76,646,235 L295P probably damaging Het
Cyp4a12b A G 4: 115,432,563 D209G possibly damaging Het
Ddx23 T C 15: 98,648,689 E533G probably damaging Het
Eif3l T G 15: 79,084,136 C202G probably benign Het
Ephx4 T G 5: 107,429,746 M312R probably damaging Het
Far2 G A 6: 148,173,913 D424N probably damaging Het
Fat1 C A 8: 45,036,184 N3497K probably damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Fyb2 A T 4: 105,013,302 H700L probably benign Het
Gm438 A G 4: 144,777,951 L210P probably damaging Het
Gm8356 T A 14: 6,535,135 M128L probably benign Het
Grm1 T G 10: 10,746,659 D440A probably benign Het
Gtf2a1 A G 12: 91,562,973 V322A probably benign Het
Igfals G A 17: 24,879,988 V18M possibly damaging Het
Klk1b24 G T 7: 44,190,264 probably null Het
Lmbr1 T C 5: 29,346,852 probably benign Het
Lrrc40 T C 3: 158,040,557 S90P probably benign Het
Mapk9 T C 11: 49,872,836 Y185H probably damaging Het
Marveld2 C T 13: 100,611,560 G337D probably damaging Het
Mga G T 2: 119,946,229 R1539L probably damaging Het
Mllt6 T A 11: 97,672,616 S342T probably benign Het
Ms4a6c T C 19: 11,472,529 probably null Het
Muc16 T A 9: 18,646,768 H2743L unknown Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1130 T C 2: 87,607,937 F183S probably damaging Het
Olfr166 A G 16: 19,487,003 H55R possibly damaging Het
Plcd3 T G 11: 103,071,719 K635N probably damaging Het
Prkch T A 12: 73,585,527 probably null Het
Rb1cc1 T C 1: 6,274,217 V1570A probably damaging Het
Rp1 T C 1: 4,345,481 N1803D probably benign Het
Rufy3 T A 5: 88,598,472 V72E probably benign Het
Secisbp2l G A 2: 125,771,532 Q181* probably null Het
Sgcb A G 5: 73,639,845 F191L possibly damaging Het
Sgsh T A 11: 119,346,357 D477V probably damaging Het
Slc22a28 C A 19: 8,071,127 S385I probably benign Het
Slco2a1 A T 9: 103,067,986 I187F probably damaging Het
Sltm T C 9: 70,573,897 S344P unknown Het
Stab1 A G 14: 31,160,317 F474L probably benign Het
Tbc1d5 G T 17: 50,917,545 A326E possibly damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr70 G A 15: 7,922,081 T425I probably benign Het
Zfp30 T C 7: 29,792,806 Y243H probably benign Het
Zfp974 A T 7: 27,912,134 N55K possibly damaging Het
Other mutations in Sort1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sort1 APN 3 108356307 missense probably damaging 0.99
IGL01677:Sort1 APN 3 108344885 missense probably benign 0.05
IGL02532:Sort1 APN 3 108325720 missense probably benign 0.44
IGL03354:Sort1 APN 3 108348706 missense probably benign 0.00
R0266:Sort1 UTSW 3 108344931 missense probably benign 0.09
R0277:Sort1 UTSW 3 108324592 splice site probably benign
R0559:Sort1 UTSW 3 108356579 missense probably damaging 1.00
R0597:Sort1 UTSW 3 108338910 missense probably damaging 1.00
R0624:Sort1 UTSW 3 108348630 missense probably damaging 1.00
R1803:Sort1 UTSW 3 108325699 missense probably damaging 1.00
R1872:Sort1 UTSW 3 108340695 missense probably benign 0.01
R1986:Sort1 UTSW 3 108345727 missense possibly damaging 0.71
R2130:Sort1 UTSW 3 108351686 missense probably benign
R2131:Sort1 UTSW 3 108351686 missense probably benign
R2133:Sort1 UTSW 3 108351686 missense probably benign
R2362:Sort1 UTSW 3 108346665 missense possibly damaging 0.89
R3436:Sort1 UTSW 3 108337807 missense probably damaging 1.00
R3548:Sort1 UTSW 3 108337909 missense possibly damaging 0.83
R3700:Sort1 UTSW 3 108356639 nonsense probably null
R4496:Sort1 UTSW 3 108310145 missense probably benign 0.17
R4616:Sort1 UTSW 3 108355541 missense possibly damaging 0.66
R4632:Sort1 UTSW 3 108346678 missense probably damaging 1.00
R4749:Sort1 UTSW 3 108356323 nonsense probably null
R4994:Sort1 UTSW 3 108328069 missense probably damaging 0.99
R5187:Sort1 UTSW 3 108324676 missense probably damaging 1.00
R5753:Sort1 UTSW 3 108345774 missense probably damaging 1.00
R6019:Sort1 UTSW 3 108357233 missense possibly damaging 0.77
R6262:Sort1 UTSW 3 108310211 missense probably damaging 1.00
R7369:Sort1 UTSW 3 108351680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTCCAGCCTCTAAGTCGG -3'
(R):5'- ACCATCGGATTCCCCTGTAGAC -3'

Sequencing Primer
(F):5'- AGCCTCTAAGTCGGATGCTAG -3'
(R):5'- TAGCCCACTGAGCTGAAGG -3'
Posted On2019-10-07