Incidental Mutation 'R1879:Olfr652'
ID211389
Institutional Source Beutler Lab
Gene Symbol Olfr652
Ensembl Gene ENSMUSG00000073927
Gene Nameolfactory receptor 652
SynonymsMOR31-8, GA_x6K02T2PBJ9-7191524-7192471
MMRRC Submission 039900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1879 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104560901-104568634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104564911 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 230 (V230A)
Ref Sequence ENSEMBL: ENSMUSP00000152027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098175] [ENSMUST00000215410] [ENSMUST00000216131] [ENSMUST00000219111]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098175
AA Change: V230A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095777
Gene: ENSMUSG00000073927
AA Change: V230A

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:7tm_4 36 315 2.6e-105 PFAM
Pfam:7TM_GPCR_Srsx 40 312 6.9e-9 PFAM
Pfam:7tm_1 46 297 4.7e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215410
AA Change: V230A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216131
AA Change: V230A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219111
AA Change: V230A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,476 D268G possibly damaging Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abce1 T C 8: 79,687,456 N542S probably benign Het
Abcf1 T A 17: 35,961,812 E260D probably benign Het
Ahcy A G 2: 155,064,152 probably null Het
Akap13 C T 7: 75,610,727 A1033V probably benign Het
Alkbh6 A G 7: 30,311,895 N46S probably damaging Het
Ankrd34c A C 9: 89,730,073 L72V probably damaging Het
Arf4 T A 14: 26,646,921 N25K probably damaging Het
Arhgef4 A G 1: 34,722,440 D259G unknown Het
Cavin1 C A 11: 100,970,210 G86V probably damaging Het
Ces1d G A 8: 93,189,498 T167I probably benign Het
Cfb T C 17: 34,860,560 I754V probably benign Het
Clcnkb C T 4: 141,407,819 R536H possibly damaging Het
Clpb T G 7: 101,706,483 S181R probably benign Het
Col1a1 T C 11: 94,951,225 M1366T unknown Het
Cped1 T A 6: 22,085,015 probably null Het
Crip1 G A 12: 113,153,332 C82Y probably damaging Het
Csmd3 T C 15: 47,657,519 T2810A possibly damaging Het
Cyp2b9 A T 7: 26,198,569 D266V probably damaging Het
Cyp46a1 A G 12: 108,353,126 D294G probably damaging Het
Dst A G 1: 34,188,843 E1514G probably benign Het
Dync1h1 A G 12: 110,624,636 E1046G probably benign Het
Eya2 T C 2: 165,664,806 V4A probably benign Het
Frem3 A T 8: 80,611,938 R287* probably null Het
Fuca2 T A 10: 13,507,256 C323S possibly damaging Het
Ggt7 T C 2: 155,514,787 E4G possibly damaging Het
Gli1 C T 10: 127,333,737 R383H probably damaging Het
Gm4559 C A 7: 142,274,261 V35F unknown Het
Gpm6a T A 8: 55,037,330 C14S probably damaging Het
Hcn2 A T 10: 79,726,189 I340F probably benign Het
Hdac9 T A 12: 34,390,333 D349V probably damaging Het
Krt34 T C 11: 100,038,292 D364G possibly damaging Het
Mon2 C T 10: 123,002,885 R1565H probably damaging Het
Myb T A 10: 21,141,977 M482L probably benign Het
Nckap1l A T 15: 103,464,601 I294F probably benign Het
Nr2e1 A G 10: 42,568,371 probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1282 A T 2: 111,335,463 I205N possibly damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr398 T A 11: 73,984,542 D22V probably benign Het
Pde8b A T 13: 95,085,215 I308N possibly damaging Het
Pdzd2 T C 15: 12,373,900 R2050G possibly damaging Het
Phc3 C A 3: 30,914,458 S840I probably damaging Het
Piezo2 T A 18: 63,113,960 Y327F probably damaging Het
Pnliprp1 A T 19: 58,744,084 I460F probably benign Het
Pphln1 T G 15: 93,424,046 D35E probably damaging Het
Prdm6 G A 18: 53,568,217 V360I probably damaging Het
Rab35 T A 5: 115,640,160 W62R probably damaging Het
Sct G T 7: 141,278,699 P70Q probably damaging Het
Sdf4 A G 4: 156,009,847 N328S probably damaging Het
Senp5 A T 16: 31,983,824 S488R probably damaging Het
Serpina3n A G 12: 104,408,954 E95G probably benign Het
Sfswap C T 5: 129,541,328 A442V probably benign Het
Sgcd T C 11: 47,355,241 I45V probably benign Het
Sgcg T C 14: 61,236,897 probably null Het
Slc39a12 G T 2: 14,444,057 V489L probably benign Het
Slc5a11 T A 7: 123,239,448 I96N possibly damaging Het
Slc6a12 A G 6: 121,347,423 D2G probably damaging Het
Slc8a1 T C 17: 81,648,013 D532G probably damaging Het
Smarcd3 C A 5: 24,593,021 C465F probably damaging Het
Smc1b T A 15: 85,092,067 Q813L probably benign Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sptan1 A T 2: 29,995,528 N715I probably damaging Het
Tas1r2 T A 4: 139,669,695 Y782N probably damaging Het
Thap3 A T 4: 151,983,136 C162S probably benign Het
Topaz1 T A 9: 122,749,619 D531E possibly damaging Het
Vmn1r25 C T 6: 57,978,927 A126T possibly damaging Het
Zfhx2 A G 14: 55,065,617 F1637L probably benign Het
Zfhx2 T C 14: 55,072,749 Y780C possibly damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp956 A T 6: 47,963,744 T346S probably benign Het
Zkscan1 C T 5: 138,097,148 A219V probably damaging Het
Other mutations in Olfr652
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr652 APN 7 104564829 missense probably damaging 1.00
IGL01620:Olfr652 APN 7 104565013 missense probably damaging 0.97
IGL01712:Olfr652 APN 7 104565019 missense probably benign
IGL02211:Olfr652 APN 7 104565126 nonsense probably null
IGL03328:Olfr652 APN 7 104564470 missense probably damaging 1.00
K7894:Olfr652 UTSW 7 104564532 missense probably benign 0.12
R0138:Olfr652 UTSW 7 104565003 missense probably benign
R0632:Olfr652 UTSW 7 104564337 missense probably benign 0.00
R1457:Olfr652 UTSW 7 104565071 missense probably damaging 1.00
R1494:Olfr652 UTSW 7 104564831 nonsense probably null
R2188:Olfr652 UTSW 7 104564676 missense probably benign 0.00
R2323:Olfr652 UTSW 7 104564619 missense probably benign 0.01
R3862:Olfr652 UTSW 7 104564938 missense probably benign 0.01
R3908:Olfr652 UTSW 7 104564641 missense probably benign 0.01
R4942:Olfr652 UTSW 7 104565005 missense probably benign 0.00
R5443:Olfr652 UTSW 7 104564376 missense probably benign 0.14
R5572:Olfr652 UTSW 7 104564994 missense probably benign 0.08
R6045:Olfr652 UTSW 7 104564767 missense probably benign 0.42
R6973:Olfr652 UTSW 7 104564976 missense probably benign 0.42
R7147:Olfr652 UTSW 7 104564066 start gained probably benign
R7349:Olfr652 UTSW 7 104564650 missense probably benign
R8031:Olfr652 UTSW 7 104565109 missense not run
X0024:Olfr652 UTSW 7 104564250 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTTCTTGCTAAAACGACTGCC -3'
(R):5'- CCATAGATGACTGGGTTGATGGC -3'

Sequencing Primer
(F):5'- AAAACGACTGCCTTTCTGCCG -3'
(R):5'- ATGACTGGGTTGATGGCAGGAG -3'
Posted On2014-06-30