Incidental Mutation 'R1925:Catsperg2'
ID213349
Institutional Source Beutler Lab
Gene Symbol Catsperg2
Ensembl Gene ENSMUSG00000049123
Gene Namecation channel sperm associated auxiliary subunit gamma 2
Synonyms1700067C01Rik, CATSPERG
MMRRC Submission 039943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1925 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29697219-29727032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29697764 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1105 (M1105V)
Ref Sequence ENSEMBL: ENSMUSP00000147099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061193] [ENSMUST00000207115] [ENSMUST00000208371] [ENSMUST00000208607] [ENSMUST00000209126]
Predicted Effect probably benign
Transcript: ENSMUST00000061193
AA Change: M1105V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000052285
Gene: ENSMUSG00000049123
AA Change: M1105V

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207115
Predicted Effect probably benign
Transcript: ENSMUST00000208371
Predicted Effect probably benign
Transcript: ENSMUST00000208607
Predicted Effect probably benign
Transcript: ENSMUST00000209126
AA Change: M1105V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,671,607 H577R probably damaging Het
Acvr1 T C 2: 58,447,649 M474V probably damaging Het
Adam1a A T 5: 121,519,450 C593* probably null Het
Agap2 A G 10: 127,090,875 N927S probably damaging Het
Ahctf1 T C 1: 179,770,653 H958R probably damaging Het
Apaf1 A G 10: 90,999,719 V1088A probably damaging Het
Brpf1 G T 6: 113,319,930 K958N probably damaging Het
Cadps A G 14: 12,705,726 I223T probably damaging Het
Clasp2 T A 9: 113,906,197 F1033L possibly damaging Het
Col4a3 T A 1: 82,700,373 I1232N unknown Het
Col4a3 T G 1: 82,711,874 probably benign Het
Comtd1 T G 14: 21,847,663 E134A probably damaging Het
Cyp2c55 A T 19: 39,034,377 T320S probably benign Het
Dlx2 T C 2: 71,546,178 N72S probably benign Het
Dnhd1 T A 7: 105,652,252 V272E probably damaging Het
Dnhd1 T A 7: 105,673,854 I523N probably damaging Het
Dpysl3 T A 18: 43,332,931 I140F probably damaging Het
Elmod2 G A 8: 83,321,464 A123V probably benign Het
Etv4 T C 11: 101,771,681 probably benign Het
F3 A T 3: 121,729,383 T81S probably damaging Het
Faf2 C T 13: 54,652,052 A224V probably damaging Het
Fbn1 A T 2: 125,363,629 M1109K probably damaging Het
Fnbp4 A G 2: 90,765,843 E586G probably damaging Het
Gm10428 G T 11: 62,753,353 probably benign Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Gm5884 A T 6: 128,645,087 noncoding transcript Het
Gm6471 T A 7: 142,831,582 noncoding transcript Het
Gtse1 T C 15: 85,873,738 V515A probably benign Het
H2-M2 T C 17: 37,482,500 E205G probably damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Il1r2 A G 1: 40,115,148 Y225C probably damaging Het
Kcnq3 T G 15: 66,004,809 D495A possibly damaging Het
Lrrc49 T C 9: 60,649,490 N321D probably benign Het
Lztr1 G T 16: 17,523,383 R291L probably damaging Het
Micu1 C T 10: 59,733,161 probably benign Het
Msh5 C T 17: 35,029,952 V702I probably benign Het
Myh1 T C 11: 67,211,170 I792T probably benign Het
Nav1 T A 1: 135,607,229 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1044 T C 2: 86,171,010 D269G probably benign Het
Olfr204 A G 16: 59,314,664 S248P probably damaging Het
Olfr266 C T 3: 106,822,372 M62I probably damaging Het
Otof G C 5: 30,394,188 N340K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plek2 T A 12: 78,894,890 Y155F probably damaging Het
Ppa1 T A 10: 61,651,609 Y38* probably null Het
Prmt9 T A 8: 77,577,339 C684S possibly damaging Het
Rasl10a A G 11: 5,059,473 D87G possibly damaging Het
Rtn4rl1 C A 11: 75,266,038 P432Q probably benign Het
Scd4 T G 19: 44,341,384 Y265D probably damaging Het
Scn5a C T 9: 119,529,019 A719T probably benign Het
Sdk1 T A 5: 142,185,285 F1968I probably benign Het
Sh3bp5 T C 14: 31,435,923 E12G probably benign Het
Slc6a12 T A 6: 121,360,526 F390I probably benign Het
Snapin A T 3: 90,490,232 D77E possibly damaging Het
Sox2 G T 3: 34,650,671 E86* probably null Het
Sparcl1 A G 5: 104,093,354 L68P probably benign Het
Sptb T A 12: 76,622,253 E562V probably damaging Het
Taar3 A T 10: 23,950,585 H343L probably benign Het
Tanc1 T A 2: 59,724,751 V51E possibly damaging Het
Tbc1d22a T C 15: 86,239,149 S128P probably damaging Het
Thada A G 17: 84,444,499 S350P probably benign Het
Tmem161b T C 13: 84,260,229 V93A probably benign Het
Tnn T C 1: 160,097,229 Y1185C probably damaging Het
Trim43a T C 9: 88,582,318 V94A probably benign Het
Ttll12 C T 15: 83,581,775 E407K probably benign Het
Ttn T C 2: 76,725,512 E30383G probably damaging Het
Vmn1r29 T A 6: 58,308,102 M269K possibly damaging Het
Vmn2r117 A G 17: 23,478,389 S110P probably benign Het
Vmn2r6 C A 3: 64,556,277 V290L possibly damaging Het
Vmn2r8 A T 5: 108,802,153 L276Q probably damaging Het
Zan C A 5: 137,425,642 C2665F unknown Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp983 A G 17: 21,662,017 H287R probably damaging Het
Other mutations in Catsperg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Catsperg2 APN 7 29705404 missense possibly damaging 0.86
IGL00095:Catsperg2 APN 7 29698058 missense possibly damaging 0.73
IGL00902:Catsperg2 APN 7 29701143 missense possibly damaging 0.93
IGL01667:Catsperg2 APN 7 29710133 missense probably damaging 0.98
IGL01791:Catsperg2 APN 7 29704665 splice site probably null
IGL01961:Catsperg2 APN 7 29721672 splice site probably benign
IGL02187:Catsperg2 APN 7 29721366 missense probably benign 0.02
IGL02605:Catsperg2 APN 7 29719565 missense possibly damaging 0.71
IGL03001:Catsperg2 APN 7 29725079 missense probably benign 0.32
IGL03228:Catsperg2 APN 7 29698225 missense probably damaging 0.96
IGL03239:Catsperg2 APN 7 29697716 missense probably benign 0.04
IGL03242:Catsperg2 APN 7 29725479 unclassified probably benign
IGL03247:Catsperg2 APN 7 29717048 missense possibly damaging 0.71
IGL03256:Catsperg2 APN 7 29709874 missense probably damaging 0.99
PIT4520001:Catsperg2 UTSW 7 29710161 missense possibly damaging 0.93
R0052:Catsperg2 UTSW 7 29725020 splice site probably benign
R0281:Catsperg2 UTSW 7 29706571 missense possibly damaging 0.86
R0357:Catsperg2 UTSW 7 29714901 missense possibly damaging 0.93
R0480:Catsperg2 UTSW 7 29721298 missense probably damaging 0.98
R0578:Catsperg2 UTSW 7 29704691 missense possibly damaging 0.71
R0732:Catsperg2 UTSW 7 29700696 missense probably damaging 1.00
R0826:Catsperg2 UTSW 7 29705624 missense possibly damaging 0.92
R1535:Catsperg2 UTSW 7 29698246 missense possibly damaging 0.85
R1990:Catsperg2 UTSW 7 29721045 nonsense probably null
R3433:Catsperg2 UTSW 7 29701218 missense possibly damaging 0.71
R3721:Catsperg2 UTSW 7 29705102 missense probably benign 0.02
R4020:Catsperg2 UTSW 7 29717004 missense probably damaging 0.99
R4760:Catsperg2 UTSW 7 29705635 missense probably damaging 0.99
R4829:Catsperg2 UTSW 7 29701125 missense probably damaging 0.98
R5033:Catsperg2 UTSW 7 29710134 missense possibly damaging 0.93
R5093:Catsperg2 UTSW 7 29716998 missense probably benign 0.32
R5266:Catsperg2 UTSW 7 29717066 missense probably damaging 0.98
R5267:Catsperg2 UTSW 7 29717066 missense probably damaging 0.98
R5287:Catsperg2 UTSW 7 29697838 missense possibly damaging 0.96
R5427:Catsperg2 UTSW 7 29714850 missense possibly damaging 0.71
R5575:Catsperg2 UTSW 7 29705590 missense possibly damaging 0.84
R5685:Catsperg2 UTSW 7 29701188 missense probably damaging 1.00
R5844:Catsperg2 UTSW 7 29697832 missense possibly damaging 0.96
R5982:Catsperg2 UTSW 7 29713017 missense possibly damaging 0.51
R6662:Catsperg2 UTSW 7 29719513 start gained probably benign
R6744:Catsperg2 UTSW 7 29709819 missense probably benign 0.23
R7171:Catsperg2 UTSW 7 29705325 missense possibly damaging 0.71
R7239:Catsperg2 UTSW 7 29710082 missense probably benign 0.00
R7336:Catsperg2 UTSW 7 29706601 missense possibly damaging 0.83
R7498:Catsperg2 UTSW 7 29717102 missense possibly damaging 0.71
R7548:Catsperg2 UTSW 7 29709826 missense probably benign 0.32
R7562:Catsperg2 UTSW 7 29697719 missense probably benign 0.18
R7565:Catsperg2 UTSW 7 29712981 missense probably null 0.71
R7600:Catsperg2 UTSW 7 29704858 missense probably benign 0.32
Z1177:Catsperg2 UTSW 7 29697782 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAGGCCTAAGGGTTCATGAG -3'
(R):5'- GACCTCCTTCATTGTTATGGTGAG -3'

Sequencing Primer
(F):5'- CCTAAGGGTTCATGAGGAAGAGTAC -3'
(R):5'- GCAGGGGGTTCACCTACTACTATAC -3'
Posted On2014-07-14