Incidental Mutation 'R1941:Fam117a'
ID214025
Institutional Source Beutler Lab
Gene Symbol Fam117a
Ensembl Gene ENSMUSG00000038893
Gene Namefamily with sequence similarity 117, member A
Synonyms
MMRRC Submission 039959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R1941 (G1)
Quality Score118
Status Not validated
Chromosome11
Chromosomal Location95337018-95381872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95380798 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 399 (N399Y)
Ref Sequence ENSEMBL: ENSMUSP00000049162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021243] [ENSMUST00000037502] [ENSMUST00000131193] [ENSMUST00000146556] [ENSMUST00000232252]
Predicted Effect probably benign
Transcript: ENSMUST00000021243
SMART Domains Protein: ENSMUSP00000021243
Gene: ENSMUSG00000020873

DomainStartEndE-ValueType
Pfam:TPT 12 309 1.3e-14 PFAM
Pfam:UAA 13 313 2.1e-58 PFAM
Pfam:EamA 170 309 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000037502
AA Change: N399Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049162
Gene: ENSMUSG00000038893
AA Change: N399Y

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
Pfam:FAM117 86 397 3.6e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131193
SMART Domains Protein: ENSMUSP00000125307
Gene: ENSMUSG00000020873

DomainStartEndE-ValueType
Pfam:UAA 14 91 5.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141284
Predicted Effect probably benign
Transcript: ENSMUST00000146556
SMART Domains Protein: ENSMUSP00000125597
Gene: ENSMUSG00000020873

DomainStartEndE-ValueType
low complexity region 14 23 N/A INTRINSIC
Pfam:EmrE 38 149 3.9e-9 PFAM
Pfam:UAA 46 153 4.5e-30 PFAM
Pfam:EamA 63 146 1.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189860
Predicted Effect probably benign
Transcript: ENSMUST00000232252
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Fam117a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02821:Fam117a APN 11 95363989 splice site probably benign
IGL03027:Fam117a APN 11 95377573 missense probably benign 0.00
R0328:Fam117a UTSW 11 95375626 splice site probably benign
R0603:Fam117a UTSW 11 95380873 missense probably damaging 0.99
R1779:Fam117a UTSW 11 95378953 missense probably damaging 1.00
R4801:Fam117a UTSW 11 95364070 missense probably damaging 0.99
R4802:Fam117a UTSW 11 95364070 missense probably damaging 0.99
R5328:Fam117a UTSW 11 95364170 critical splice donor site probably null
R5368:Fam117a UTSW 11 95375633 missense probably damaging 0.98
R6166:Fam117a UTSW 11 95380781 missense possibly damaging 0.89
R6267:Fam117a UTSW 11 95364145 missense possibly damaging 0.93
R6296:Fam117a UTSW 11 95364145 missense possibly damaging 0.93
R7077:Fam117a UTSW 11 95377672 missense probably benign 0.01
R7354:Fam117a UTSW 11 95380703 missense probably damaging 1.00
R7670:Fam117a UTSW 11 95378834 missense probably benign 0.00
R7673:Fam117a UTSW 11 95371496 missense probably benign 0.15
Z1088:Fam117a UTSW 11 95371524 missense possibly damaging 0.50
Z1177:Fam117a UTSW 11 95375025 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTTGAGCAGGAACCCAGC -3'
(R):5'- CCAAGGCACTAGTCTCCATG -3'

Sequencing Primer
(F):5'- TGAGGCAGTCACCCTTCCAG -3'
(R):5'- GCACTAGTCTCCATGGTAAAGTG -3'
Posted On2014-07-14