Incidental Mutation 'R7077:Fam117a'
ID549289
Institutional Source Beutler Lab
Gene Symbol Fam117a
Ensembl Gene ENSMUSG00000038893
Gene Namefamily with sequence similarity 117, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location95337018-95381872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95377672 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 300 (G300S)
Ref Sequence ENSEMBL: ENSMUSP00000049162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037502]
Predicted Effect probably benign
Transcript: ENSMUST00000037502
AA Change: G300S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000049162
Gene: ENSMUSG00000038893
AA Change: G300S

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
Pfam:FAM117 86 397 3.6e-116 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Fam117a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02821:Fam117a APN 11 95363989 splice site probably benign
IGL03027:Fam117a APN 11 95377573 missense probably benign 0.00
R0328:Fam117a UTSW 11 95375626 splice site probably benign
R0603:Fam117a UTSW 11 95380873 missense probably damaging 0.99
R1779:Fam117a UTSW 11 95378953 missense probably damaging 1.00
R1941:Fam117a UTSW 11 95380798 missense probably damaging 1.00
R4801:Fam117a UTSW 11 95364070 missense probably damaging 0.99
R4802:Fam117a UTSW 11 95364070 missense probably damaging 0.99
R5328:Fam117a UTSW 11 95364170 critical splice donor site probably null
R5368:Fam117a UTSW 11 95375633 missense probably damaging 0.98
R6166:Fam117a UTSW 11 95380781 missense possibly damaging 0.89
R6267:Fam117a UTSW 11 95364145 missense possibly damaging 0.93
R6296:Fam117a UTSW 11 95364145 missense possibly damaging 0.93
R7354:Fam117a UTSW 11 95380703 missense probably damaging 1.00
R7670:Fam117a UTSW 11 95378834 missense probably benign 0.00
R7673:Fam117a UTSW 11 95371496 missense probably benign 0.15
Z1088:Fam117a UTSW 11 95371524 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGAGAAGACCCTGGACTGAG -3'
(R):5'- GTCAGAGTGCTGTAAGGACC -3'

Sequencing Primer
(F):5'- GAAGACCCTGGACTGAGTCTCTTC -3'
(R):5'- GCTGTAAGGACCATTATTATCACAGG -3'
Posted On2019-05-15