Incidental Mutation 'R0132:Cttnbp2nl'
ID21678
Institutional Source Beutler Lab
Gene Symbol Cttnbp2nl
Ensembl Gene ENSMUSG00000062127
Gene NameCTTNBP2 N-terminal like
Synonyms
MMRRC Submission 038417-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R0132 (G1)
Quality Score197
Status Validated (trace)
Chromosome3
Chromosomal Location105001915-105053146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 105005857 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 237 (K237T)
Ref Sequence ENSEMBL: ENSMUSP00000096359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077548] [ENSMUST00000098763] [ENSMUST00000197437]
Predicted Effect probably damaging
Transcript: ENSMUST00000077548
AA Change: K237T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076751
Gene: ENSMUSG00000062127
AA Change: K237T

DomainStartEndE-ValueType
Pfam:CortBP2 1 189 1.9e-60 PFAM
low complexity region 263 278 N/A INTRINSIC
low complexity region 401 434 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 578 586 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098763
AA Change: K237T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096359
Gene: ENSMUSG00000062127
AA Change: K237T

DomainStartEndE-ValueType
Pfam:CortBP2 2 188 8.5e-71 PFAM
low complexity region 263 278 N/A INTRINSIC
low complexity region 401 434 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 578 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197437
SMART Domains Protein: ENSMUSP00000143282
Gene: ENSMUSG00000062127

DomainStartEndE-ValueType
Pfam:CortBP2 1 167 7.7e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199002
Meta Mutation Damage Score 0.2174 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.2%
  • 20x: 84.8%
Validation Efficiency 90% (52/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Cttnbp2nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Cttnbp2nl APN 3 105005030 missense probably damaging 1.00
IGL01832:Cttnbp2nl APN 3 105011228 missense probably damaging 1.00
IGL02070:Cttnbp2nl APN 3 105011266 missense probably damaging 1.00
R0131:Cttnbp2nl UTSW 3 105005857 missense probably damaging 1.00
R0131:Cttnbp2nl UTSW 3 105005857 missense probably damaging 1.00
R1919:Cttnbp2nl UTSW 3 105011278 missense possibly damaging 0.51
R3766:Cttnbp2nl UTSW 3 105004801 missense probably benign 0.27
R3964:Cttnbp2nl UTSW 3 105006005 missense probably damaging 1.00
R4509:Cttnbp2nl UTSW 3 105032747 missense probably damaging 1.00
R4597:Cttnbp2nl UTSW 3 105005875 missense possibly damaging 0.76
R4820:Cttnbp2nl UTSW 3 105011324 missense probably benign 0.00
R5233:Cttnbp2nl UTSW 3 105005041 missense probably damaging 1.00
R6230:Cttnbp2nl UTSW 3 105011339 missense probably damaging 0.99
R6385:Cttnbp2nl UTSW 3 105005636 missense probably benign 0.41
R6551:Cttnbp2nl UTSW 3 105005117 missense possibly damaging 0.92
R6685:Cttnbp2nl UTSW 3 105005498 missense probably benign 0.06
R6883:Cttnbp2nl UTSW 3 105011191 critical splice donor site probably null
R7262:Cttnbp2nl UTSW 3 105032746 missense probably damaging 1.00
R7509:Cttnbp2nl UTSW 3 105032730 missense possibly damaging 0.94
R7619:Cttnbp2nl UTSW 3 105004760 missense possibly damaging 0.73
X0060:Cttnbp2nl UTSW 3 105005218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGACAAAACGCAGACACTCGC -3'
(R):5'- ACAAGCAGCTCTCTTCCATGCTGG -3'

Sequencing Primer
(F):5'- TGCCTCTGGACATGGTCAC -3'
(R):5'- TTCCATGCTGGTGCTCG -3'
Posted On2013-04-11