Mutagenetix > Incidental Mutation

Incidental Mutation 'R0132:Ptprt'

21673

Institutional Source

Beutler Lab

Gene Symbol

Ptprt

Ensembl Gene

ENSMUSG00000053141

Gene Name

protein tyrosine phosphatase, receptor type, T

Synonyms

RPTPrho

MMRRC Submission

038417-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R0132 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

161521990-162661147 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 162278110 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 146 (V146I)

Ref Sequence

ENSEMBL: ENSMUSP00000105068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000109441
AA Change: V146I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: V146I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1159	3.64e-129	SMART
PTPc	1188	1453	4.24e-98	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109442
AA Change: V146I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: V146I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	738	749	N/A	INTRINSIC
transmembrane domain	772	791	N/A	INTRINSIC
PTPc	901	1158	5.56e-134	SMART
PTPc	1187	1452	4.24e-98	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109443
AA Change: V146I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: V146I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	778	792	N/A	INTRINSIC
PTPc	892	1149	5.56e-134	SMART
PTPc	1178	1443	4.24e-98	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109445
AA Change: V146I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: V146I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1139	5.56e-134	SMART
PTPc	1168	1433	4.24e-98	SMART

Meta Mutation Damage Score

0.0675

Coding Region Coverage

1x: 99.1%
3x: 97.9%
10x: 94.2%
20x: 84.8%

Validation Efficiency

90% (52/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	G	7: 28,137,615	R320G	probably damaging	Het
Abcc12	A	G	8: 86,531,568	I773T	probably benign	Het
Adamtsl1	T	A	4: 86,342,723	I1057N	possibly damaging	Het
Anxa5	G	A	3: 36,450,672	A247V	probably damaging	Het
Ascc3	T	G	10: 50,735,329	W1589G	probably damaging	Het
Atp2b2	G	A	6: 113,793,782	P389S	probably damaging	Het
Bpifa6	T	A	2: 153,982,931	S9T	probably benign	Het
Chd8	A	G	14: 52,205,326	V589A	probably benign	Het
Chrnb2	T	C	3: 89,764,406	M1V	probably null	Het
Col16a1	T	A	4: 130,067,096	V449E	unknown	Het
Cttnbp2nl	T	G	3: 105,005,857	K237T	probably damaging	Het
Dazap1	T	G	10: 80,278,226		probably null	Het
Fam187b	T	A	7: 30,989,120	V22E	probably damaging	Het
Gm4788	T	A	1: 139,754,271	T196S	probably damaging	Het
H2-T24	T	A	17: 36,014,986	I238F	probably damaging	Het
Hectd4	A	G	5: 121,333,024	E2658G	probably benign	Het
Herc1	A	C	9: 66,480,910	I3826L	probably benign	Het
Hinfp	A	G	9: 44,299,763	C67R	probably damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Hspg2	T	C	4: 137,551,887	Y3094H	probably damaging	Het
Htr1f	A	G	16: 64,926,728	V67A	probably damaging	Het
Iqcc	T	G	4: 129,616,599	E374D	probably damaging	Het
Kcnj9	T	C	1: 172,326,198	T120A	probably damaging	Het
Kitl	C	T	10: 100,087,364	P208S	probably benign	Het
Lpcat4	A	G	2: 112,246,748	Y479C	probably damaging	Het
Lrrc74b	T	C	16: 17,553,152	N227S	probably damaging	Het
Mdc1	T	A	17: 35,852,581	V1007D	probably damaging	Het
Mocos	T	G	18: 24,679,762	I571S	probably benign	Het
Myh8	A	G	11: 67,292,188	N659D	probably damaging	Het
Naip2	A	G	13: 100,183,788	V240A	probably benign	Het
Nap1l1	T	C	10: 111,485,509	S37P	probably benign	Het
Nin	T	G	12: 70,051,141	K515T	probably damaging	Het
Npl	T	A	1: 153,509,118	K258*	probably null	Het
Ntn4	T	A	10: 93,644,707	S98T	possibly damaging	Het
Olfr177	C	A	16: 58,872,906	M81I	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr417	T	C	1: 174,369,586	V223A	probably damaging	Het
Ppox	C	A	1: 171,279,275	A192S	possibly damaging	Het
Prkdc	T	C	16: 15,713,653	L1380S	probably benign	Het
Psd4	C	A	2: 24,405,351	A839E	probably damaging	Het
Ptprn2	T	G	12: 116,722,091	F57V	probably damaging	Het
R3hdm2	T	A	10: 127,498,453	M915K	probably damaging	Het
Rab26	C	T	17: 24,530,785		probably null	Het
Rnf213	A	G	11: 119,430,361	E1215G	probably benign	Het
Rprd2	T	C	3: 95,774,361	K407E	probably damaging	Het
Siah3	G	A	14: 75,456,134	V27I	possibly damaging	Het
Slc14a2	T	A	18: 78,192,123	N280Y	probably damaging	Het
Slc25a35	A	G	11: 68,971,960	Y247C	probably damaging	Het
Slc29a4	A	G	5: 142,705,530	D55G	probably benign	Het
Slc35d1	C	T	4: 103,208,181	V189I	probably benign	Het
Srrm1	G	A	4: 135,340,573	R322*	probably null	Het
Stac3	A	T	10: 127,503,650	R138S	probably damaging	Het
Tmem260	T	A	14: 48,483,322	C306*	probably null	Het
Tspyl1	A	G	10: 34,283,089	N270S	probably damaging	Het
Ugt2a2	T	A	5: 87,474,861	K293*	probably null	Het
Vmn2r102	A	C	17: 19,678,763	T456P	probably benign	Het
Vmn2r90	T	A	17: 17,712,249	S139R	probably benign	Het
Zmym2	A	G	14: 56,943,258	N876D	probably benign	Het

Other mutations in Ptprt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ptprt	APN	2	161810624	missense	probably benign	0.00
IGL00565:Ptprt	APN	2	161560191	missense	probably damaging	1.00
IGL00925:Ptprt	APN	2	161656163	missense	possibly damaging	0.52
IGL01344:Ptprt	APN	2	161551817	missense	probably damaging	1.00
IGL01432:Ptprt	APN	2	162268079	splice site	probably benign
IGL02008:Ptprt	APN	2	161927673	missense	probably benign	0.02
IGL02040:Ptprt	APN	2	162238072	missense	probably damaging	1.00
IGL02172:Ptprt	APN	2	161555502	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162238060	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162278046	critical splice donor site	probably null
IGL02232:Ptprt	APN	2	161530517	missense	probably damaging	0.96
IGL02277:Ptprt	APN	2	161547381	missense	probably damaging	1.00
IGL02447:Ptprt	APN	2	162278107	missense	probably benign	0.01
IGL02601:Ptprt	APN	2	161766307	missense	probably benign	0.10
IGL02623:Ptprt	APN	2	161607452	splice site	probably benign
IGL03379:Ptprt	APN	2	161555459	nonsense	probably null
Poverina	UTSW	2	161901497	missense	possibly damaging	0.70
IGL03055:Ptprt	UTSW	2	161533613	missense	probably damaging	0.96
R0064:Ptprt	UTSW	2	161927791	splice site	probably benign
R0129:Ptprt	UTSW	2	162278070	missense	probably benign	0.35
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0316:Ptprt	UTSW	2	161607319	missense	probably damaging	1.00
R0454:Ptprt	UTSW	2	161553822	missense	probably damaging	0.96
R0488:Ptprt	UTSW	2	161553825	missense	probably damaging	0.99
R0573:Ptprt	UTSW	2	161551748	missense	probably damaging	1.00
R0614:Ptprt	UTSW	2	161812120	missense	possibly damaging	0.59
R0834:Ptprt	UTSW	2	161812139	splice site	probably null
R1023:Ptprt	UTSW	2	161558943	missense	probably damaging	1.00
R1184:Ptprt	UTSW	2	161927772	missense	possibly damaging	0.82
R1253:Ptprt	UTSW	2	162278226	missense	probably damaging	1.00
R1476:Ptprt	UTSW	2	161927484	missense	probably damaging	1.00
R1515:Ptprt	UTSW	2	162238034	missense	probably damaging	1.00
R1595:Ptprt	UTSW	2	161810549	critical splice donor site	probably null
R1939:Ptprt	UTSW	2	161927640	missense	probably benign	0.45
R1987:Ptprt	UTSW	2	161558898	missense	probably damaging	1.00
R1987:Ptprt	UTSW	2	161766321	missense	possibly damaging	0.48
R2049:Ptprt	UTSW	2	161534545	missense	probably damaging	1.00
R2140:Ptprt	UTSW	2	161811988	missense	probably damaging	1.00
R2421:Ptprt	UTSW	2	162278040	splice site	probably benign
R3432:Ptprt	UTSW	2	161927529	missense	probably damaging	1.00
R3619:Ptprt	UTSW	2	161566157	missense	probably damaging	1.00
R3757:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3758:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3834:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3835:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3915:Ptprt	UTSW	2	161555555	splice site	probably benign
R4003:Ptprt	UTSW	2	161566117	splice site	probably benign
R4387:Ptprt	UTSW	2	161927650	missense	probably damaging	1.00
R4519:Ptprt	UTSW	2	161564689	missense	probably damaging	1.00
R4618:Ptprt	UTSW	2	161553845	missense	probably damaging	1.00
R4677:Ptprt	UTSW	2	161901446	critical splice donor site	probably null
R4866:Ptprt	UTSW	2	161560239	missense	probably damaging	1.00
R5088:Ptprt	UTSW	2	162238175	missense	probably benign	0.01
R5173:Ptprt	UTSW	2	161927756	missense	probably benign	0.01
R5215:Ptprt	UTSW	2	162278164	missense	probably damaging	1.00
R5383:Ptprt	UTSW	2	161698049	missense	probably damaging	1.00
R5398:Ptprt	UTSW	2	161927592	missense	probably damaging	1.00
R5518:Ptprt	UTSW	2	162278223	missense	probably damaging	0.99
R5711:Ptprt	UTSW	2	161810604	missense	probably damaging	0.98
R5735:Ptprt	UTSW	2	161534564	missense	probably damaging	0.98
R5834:Ptprt	UTSW	2	161560269	missense	probably damaging	1.00
R5872:Ptprt	UTSW	2	162135218	missense	probably damaging	1.00
R5926:Ptprt	UTSW	2	161564686	missense	probably benign	0.00
R6210:Ptprt	UTSW	2	162268029	missense	probably damaging	1.00
R6285:Ptprt	UTSW	2	161901497	missense	possibly damaging	0.70
R6298:Ptprt	UTSW	2	161553859	missense	probably damaging	1.00
R6406:Ptprt	UTSW	2	161553783	missense	probably damaging	0.98
R6499:Ptprt	UTSW	2	161534587	missense	probably benign	0.32
R6613:Ptprt	UTSW	2	161530447	missense	probably damaging	1.00
R6622:Ptprt	UTSW	2	161553840	missense	probably damaging	1.00
R7218:Ptprt	UTSW	2	161547364	missense	probably damaging	1.00
R7247:Ptprt	UTSW	2	161533523	missense	probably benign	0.15
R7576:Ptprt	UTSW	2	161607305	missense	possibly damaging	0.88
R7733:Ptprt	UTSW	2	161575787	missense	probably damaging	1.00
R7735:Ptprt	UTSW	2	161575741	missense	probably damaging	1.00
R7813:Ptprt	UTSW	2	161530493	missense	probably damaging	1.00
R8031:Ptprt	UTSW	2	162135457	missense	probably damaging	1.00
R8074:Ptprt	UTSW	2	161927661	missense	possibly damaging	0.77
R8151:Ptprt	UTSW	2	162278085	missense	probably damaging	1.00
R8236:Ptprt	UTSW	2	161687068	critical splice donor site	probably null
R8308:Ptprt	UTSW	2	161927646	missense	probably benign	0.00
R8348:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8362:Ptprt	UTSW	2	161551747	missense	probably damaging	1.00
R8365:Ptprt	UTSW	2	161901531	missense	probably benign	0.05
R8448:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8512:Ptprt	UTSW	2	161558863	missense	probably benign	0.00
R8715:Ptprt	UTSW	2	161530543	missense	probably damaging	1.00
R9004:Ptprt	UTSW	2	161766394	missense	probably benign	0.04
R9046:Ptprt	UTSW	2	161530441	missense	possibly damaging	0.58
R9222:Ptprt	UTSW	2	161560186	missense	probably damaging	1.00
R9297:Ptprt	UTSW	2	161575778	missense	probably benign
R9318:Ptprt	UTSW	2	161575778	missense	probably benign
R9476:Ptprt	UTSW	2	161555461	missense	probably damaging	1.00
R9510:Ptprt	UTSW	2	161555461	missense	probably damaging	1.00
R9571:Ptprt	UTSW	2	161553812	missense	probably benign	0.10
X0064:Ptprt	UTSW	2	161927483	missense	probably damaging	1.00
Z1088:Ptprt	UTSW	2	162238121	missense	possibly damaging	0.86
Z1177:Ptprt	UTSW	2	161732887	missense	probably damaging	1.00
Z1177:Ptprt	UTSW	2	162362948	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- CATGCAAGTTGCTATGCTGGAACTG -3'
(R):5'- TGCCAACCTTGAAGGAGAATGACAC -3'

Sequencing Primer
(F):5'- CCCTGGAAAAGACTCTTCAGTATG -3'
(R):5'- GAGAATGACACTCACTGCATTG -3'

Posted On

2013-04-11