Incidental Mutation 'R0132:Stac3'
ID21703
Institutional Source Beutler Lab
Gene Symbol Stac3
Ensembl Gene ENSMUSG00000040287
Gene NameSH3 and cysteine rich domain 3
Synonyms
MMRRC Submission 038417-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0132 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location127501686-127508823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127503650 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 138 (R138S)
Ref Sequence ENSEMBL: ENSMUSP00000125124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035839] [ENSMUST00000064793] [ENSMUST00000077046] [ENSMUST00000105249] [ENSMUST00000105250] [ENSMUST00000105251] [ENSMUST00000160019] [ENSMUST00000160610] [ENSMUST00000164161] [ENSMUST00000164831] [ENSMUST00000166820] [ENSMUST00000169888] [ENSMUST00000170336]
Predicted Effect probably damaging
Transcript: ENSMUST00000035839
AA Change: R138S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048148
Gene: ENSMUSG00000040287
AA Change: R138S

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064793
SMART Domains Protein: ENSMUSP00000069724
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 699 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077046
SMART Domains Protein: ENSMUSP00000076303
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 7.4e-14 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105249
SMART Domains Protein: ENSMUSP00000100884
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.4e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 692 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105250
SMART Domains Protein: ENSMUSP00000100885
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105251
SMART Domains Protein: ENSMUSP00000100886
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160019
AA Change: R138S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125124
Gene: ENSMUSG00000040287
AA Change: R138S

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162302
Predicted Effect probably benign
Transcript: ENSMUST00000164161
SMART Domains Protein: ENSMUSP00000126185
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164831
SMART Domains Protein: ENSMUSP00000131007
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 678 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166820
SMART Domains Protein: ENSMUSP00000126608
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.7e-12 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169888
SMART Domains Protein: ENSMUSP00000126760
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
Pfam:SUZ 7 54 4.7e-12 PFAM
low complexity region 71 83 N/A INTRINSIC
low complexity region 163 194 N/A INTRINSIC
low complexity region 443 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170336
SMART Domains Protein: ENSMUSP00000128659
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 467 N/A INTRINSIC
low complexity region 712 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171426
Meta Mutation Damage Score 0.1979 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.2%
  • 20x: 84.8%
Validation Efficiency 90% (52/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the excitation-contraction coupling machinery of muscles. This protein is a member of the Stac gene family and contains an N-terminal cysteine-rich domain and two SH3 domains. Mutations in this gene are a cause of Native American myopathy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, abnormal posture, thin diaphragm muscle, abnormal skeletal muscle morphology characterized by centralized nuclei and disorganized myofibrils, and impaired skeletal muscle contractility due to defective excitation-contraction coupling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Stac3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Stac3 APN 10 127503664 missense probably damaging 1.00
IGL02271:Stac3 APN 10 127503899 missense probably benign 0.00
R0051:Stac3 UTSW 10 127508148 missense probably damaging 0.98
R0090:Stac3 UTSW 10 127503930 unclassified probably benign
R0131:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0131:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0330:Stac3 UTSW 10 127507747 synonymous probably null
R0630:Stac3 UTSW 10 127507763 missense probably damaging 1.00
R1132:Stac3 UTSW 10 127507259 missense probably benign
R1450:Stac3 UTSW 10 127504885 missense probably damaging 1.00
R1739:Stac3 UTSW 10 127507766 missense probably benign 0.40
R2316:Stac3 UTSW 10 127503360 splice site probably null
R2511:Stac3 UTSW 10 127503918 critical splice donor site probably null
R3000:Stac3 UTSW 10 127508147 missense probably benign 0.01
R4324:Stac3 UTSW 10 127503249 missense probably damaging 0.99
R4758:Stac3 UTSW 10 127503345 missense possibly damaging 0.95
R5040:Stac3 UTSW 10 127508124 missense probably damaging 0.98
R6244:Stac3 UTSW 10 127508175 missense probably damaging 1.00
R6275:Stac3 UTSW 10 127507746 nonsense probably null
R7335:Stac3 UTSW 10 127504900 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGGCAAGATTCACCCTATGAAAGCG -3'
(R):5'- ACGGGTAGTATGACACCACCTTGG -3'

Sequencing Primer
(F):5'- GCGCTGAGGTTGACAGTAG -3'
(R):5'- ACTTACAGACAGCGTACTGTTGG -3'
Posted On2013-04-11