Mutagenetix > Incidental Mutation

Incidental Mutation 'R0132:9530053A07Rik'

21690

Institutional Source

Beutler Lab

Gene Symbol

9530053A07Rik

Ensembl Gene

ENSMUSG00000078776

Gene Name

RIKEN cDNA 9530053A07 gene

Synonyms

MMRRC Submission

038417-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.171) question?

Stock #

R0132 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

28129466-28164811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 28137615 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 320 (R320G)

Ref Sequence

ENSEMBL: ENSMUSP00000114986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]

AlphaFold

E9PVG8

Predicted Effect

probably damaging
Transcript: ENSMUST00000059886
AA Change: R320G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: R320G

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129051

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130693

Predicted Effect

probably damaging
Transcript: ENSMUST00000150948
AA Change: R320G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: R320G

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Meta Mutation Damage Score

0.4767

Coding Region Coverage

1x: 99.1%
3x: 97.9%
10x: 94.2%
20x: 84.8%

Validation Efficiency

90% (52/58)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	A	G	8: 86,531,568	I773T	probably benign	Het
Adamtsl1	T	A	4: 86,342,723	I1057N	possibly damaging	Het
Anxa5	G	A	3: 36,450,672	A247V	probably damaging	Het
Ascc3	T	G	10: 50,735,329	W1589G	probably damaging	Het
Atp2b2	G	A	6: 113,793,782	P389S	probably damaging	Het
Bpifa6	T	A	2: 153,982,931	S9T	probably benign	Het
Chd8	A	G	14: 52,205,326	V589A	probably benign	Het
Chrnb2	T	C	3: 89,764,406	M1V	probably null	Het
Col16a1	T	A	4: 130,067,096	V449E	unknown	Het
Cttnbp2nl	T	G	3: 105,005,857	K237T	probably damaging	Het
Dazap1	T	G	10: 80,278,226		probably null	Het
Fam187b	T	A	7: 30,989,120	V22E	probably damaging	Het
Gm4788	T	A	1: 139,754,271	T196S	probably damaging	Het
H2-T24	T	A	17: 36,014,986	I238F	probably damaging	Het
Hectd4	A	G	5: 121,333,024	E2658G	probably benign	Het
Herc1	A	C	9: 66,480,910	I3826L	probably benign	Het
Hinfp	A	G	9: 44,299,763	C67R	probably damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Hspg2	T	C	4: 137,551,887	Y3094H	probably damaging	Het
Htr1f	A	G	16: 64,926,728	V67A	probably damaging	Het
Iqcc	T	G	4: 129,616,599	E374D	probably damaging	Het
Kcnj9	T	C	1: 172,326,198	T120A	probably damaging	Het
Kitl	C	T	10: 100,087,364	P208S	probably benign	Het
Lpcat4	A	G	2: 112,246,748	Y479C	probably damaging	Het
Lrrc74b	T	C	16: 17,553,152	N227S	probably damaging	Het
Mdc1	T	A	17: 35,852,581	V1007D	probably damaging	Het
Mocos	T	G	18: 24,679,762	I571S	probably benign	Het
Myh8	A	G	11: 67,292,188	N659D	probably damaging	Het
Naip2	A	G	13: 100,183,788	V240A	probably benign	Het
Nap1l1	T	C	10: 111,485,509	S37P	probably benign	Het
Nin	T	G	12: 70,051,141	K515T	probably damaging	Het
Npl	T	A	1: 153,509,118	K258*	probably null	Het
Ntn4	T	A	10: 93,644,707	S98T	possibly damaging	Het
Olfr177	C	A	16: 58,872,906	M81I	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr417	T	C	1: 174,369,586	V223A	probably damaging	Het
Ppox	C	A	1: 171,279,275	A192S	possibly damaging	Het
Prkdc	T	C	16: 15,713,653	L1380S	probably benign	Het
Psd4	C	A	2: 24,405,351	A839E	probably damaging	Het
Ptprn2	T	G	12: 116,722,091	F57V	probably damaging	Het
Ptprt	C	T	2: 162,278,110	V146I	probably benign	Het
R3hdm2	T	A	10: 127,498,453	M915K	probably damaging	Het
Rab26	C	T	17: 24,530,785		probably null	Het
Rnf213	A	G	11: 119,430,361	E1215G	probably benign	Het
Rprd2	T	C	3: 95,774,361	K407E	probably damaging	Het
Siah3	G	A	14: 75,456,134	V27I	possibly damaging	Het
Slc14a2	T	A	18: 78,192,123	N280Y	probably damaging	Het
Slc25a35	A	G	11: 68,971,960	Y247C	probably damaging	Het
Slc29a4	A	G	5: 142,705,530	D55G	probably benign	Het
Slc35d1	C	T	4: 103,208,181	V189I	probably benign	Het
Srrm1	G	A	4: 135,340,573	R322*	probably null	Het
Stac3	A	T	10: 127,503,650	R138S	probably damaging	Het
Tmem260	T	A	14: 48,483,322	C306*	probably null	Het
Tspyl1	A	G	10: 34,283,089	N270S	probably damaging	Het
Ugt2a2	T	A	5: 87,474,861	K293*	probably null	Het
Vmn2r102	A	C	17: 19,678,763	T456P	probably benign	Het
Vmn2r90	T	A	17: 17,712,249	S139R	probably benign	Het
Zmym2	A	G	14: 56,943,258	N876D	probably benign	Het

Other mutations in 9530053A07Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:9530053A07Rik	APN	7	28164528	missense	probably damaging	1.00
IGL00757:9530053A07Rik	APN	7	28154445	missense	probably damaging	1.00
IGL01015:9530053A07Rik	APN	7	28155318	missense	probably damaging	1.00
IGL01079:9530053A07Rik	APN	7	28139778	missense	probably damaging	0.99
IGL01343:9530053A07Rik	APN	7	28150702	missense	probably benign	0.19
IGL01420:9530053A07Rik	APN	7	28140133	missense	probably benign	0.28
IGL01604:9530053A07Rik	APN	7	28155324	missense	probably benign	0.11
IGL01666:9530053A07Rik	APN	7	28153292	missense	probably damaging	1.00
IGL02002:9530053A07Rik	APN	7	28152796	missense	probably damaging	1.00
IGL02036:9530053A07Rik	APN	7	28137525	missense	possibly damaging	0.82
IGL02126:9530053A07Rik	APN	7	28139856	missense	probably damaging	1.00
IGL02150:9530053A07Rik	APN	7	28146779	nonsense	probably null
IGL02219:9530053A07Rik	APN	7	28154635	missense	probably damaging	1.00
IGL02563:9530053A07Rik	APN	7	28157892	missense	probably benign
IGL02804:9530053A07Rik	APN	7	28153370	missense	probably benign	0.00
IGL02830:9530053A07Rik	APN	7	28162923	missense	probably damaging	1.00
IGL02943:9530053A07Rik	APN	7	28147188	missense	probably damaging	1.00
IGL02977:9530053A07Rik	APN	7	28164372	missense	possibly damaging	0.83
IGL03231:9530053A07Rik	APN	7	28153722	missense	possibly damaging	0.95
IGL03304:9530053A07Rik	APN	7	28142242	missense	probably damaging	0.99
herz	UTSW	7	28153839	missense	possibly damaging	0.72
pulse	UTSW	7	28153749	missense	probably damaging	1.00
Sinusoidal	UTSW	7	28140130	missense	probably damaging	1.00
PIT4378001:9530053A07Rik	UTSW	7	28154464	missense	possibly damaging	0.61
R0023:9530053A07Rik	UTSW	7	28153412	missense	probably benign	0.00
R0131:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0131:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0158:9530053A07Rik	UTSW	7	28155492	missense	probably damaging	1.00
R0230:9530053A07Rik	UTSW	7	28156825	missense	probably damaging	1.00
R0310:9530053A07Rik	UTSW	7	28142274	missense	probably benign	0.04
R0448:9530053A07Rik	UTSW	7	28140235	missense	probably benign	0.03
R0462:9530053A07Rik	UTSW	7	28137340	missense	probably damaging	1.00
R0481:9530053A07Rik	UTSW	7	28153749	missense	probably damaging	1.00
R0497:9530053A07Rik	UTSW	7	28147465	missense	probably damaging	1.00
R0556:9530053A07Rik	UTSW	7	28159378	missense	probably benign
R0562:9530053A07Rik	UTSW	7	28162690	missense	probably benign	0.30
R0586:9530053A07Rik	UTSW	7	28137091	missense	probably damaging	0.99
R0924:9530053A07Rik	UTSW	7	28140130	missense	probably damaging	1.00
R0930:9530053A07Rik	UTSW	7	28140130	missense	probably damaging	1.00
R1103:9530053A07Rik	UTSW	7	28154520	missense	probably damaging	1.00
R1213:9530053A07Rik	UTSW	7	28157673	missense	probably damaging	1.00
R1292:9530053A07Rik	UTSW	7	28142794	splice site	probably benign
R1368:9530053A07Rik	UTSW	7	28159478	missense	possibly damaging	0.89
R1451:9530053A07Rik	UTSW	7	28137157	missense	probably damaging	1.00
R1477:9530053A07Rik	UTSW	7	28157093	missense	probably benign	0.01
R1538:9530053A07Rik	UTSW	7	28155492	missense	probably damaging	1.00
R1655:9530053A07Rik	UTSW	7	28147110	missense	probably damaging	0.98
R1697:9530053A07Rik	UTSW	7	28154347	missense	probably damaging	1.00
R1741:9530053A07Rik	UTSW	7	28157854	missense	probably damaging	0.98
R1796:9530053A07Rik	UTSW	7	28155372	missense	probably damaging	1.00
R1853:9530053A07Rik	UTSW	7	28155546	nonsense	probably null
R1861:9530053A07Rik	UTSW	7	28154732	missense	probably damaging	1.00
R1909:9530053A07Rik	UTSW	7	28144348	missense	possibly damaging	0.52
R1971:9530053A07Rik	UTSW	7	28131512	missense	possibly damaging	0.90
R1990:9530053A07Rik	UTSW	7	28154360	missense	probably damaging	0.98
R2020:9530053A07Rik	UTSW	7	28155594	missense	probably benign
R2084:9530053A07Rik	UTSW	7	28157535	missense	probably damaging	1.00
R2125:9530053A07Rik	UTSW	7	28158022	missense	probably benign	0.00
R2132:9530053A07Rik	UTSW	7	28155474	missense	probably damaging	1.00
R2513:9530053A07Rik	UTSW	7	28131635	missense	probably damaging	0.99
R2913:9530053A07Rik	UTSW	7	28164307	missense	probably damaging	1.00
R3150:9530053A07Rik	UTSW	7	28154195	missense	probably benign	0.21
R3499:9530053A07Rik	UTSW	7	28154555	missense	probably benign	0.42
R3702:9530053A07Rik	UTSW	7	28157778	missense	probably damaging	1.00
R3881:9530053A07Rik	UTSW	7	28140038	nonsense	probably null
R3938:9530053A07Rik	UTSW	7	28154294	missense	probably damaging	1.00
R4050:9530053A07Rik	UTSW	7	28152985	missense	possibly damaging	0.55
R4152:9530053A07Rik	UTSW	7	28156897	missense	possibly damaging	0.47
R4168:9530053A07Rik	UTSW	7	28137109	missense	probably benign	0.05
R4235:9530053A07Rik	UTSW	7	28156648	missense	probably damaging	0.99
R4241:9530053A07Rik	UTSW	7	28154335	missense	probably damaging	1.00
R4363:9530053A07Rik	UTSW	7	28146906	missense	probably damaging	1.00
R4460:9530053A07Rik	UTSW	7	28152856	missense	probably benign	0.17
R4463:9530053A07Rik	UTSW	7	28150719	missense	probably benign
R4841:9530053A07Rik	UTSW	7	28150722	missense	probably damaging	1.00
R4842:9530053A07Rik	UTSW	7	28150722	missense	probably damaging	1.00
R4876:9530053A07Rik	UTSW	7	28142800	intron	probably benign
R4905:9530053A07Rik	UTSW	7	28156983	missense	possibly damaging	0.93
R4997:9530053A07Rik	UTSW	7	28143924	missense	possibly damaging	0.77
R5091:9530053A07Rik	UTSW	7	28156958	missense	probably benign	0.44
R5159:9530053A07Rik	UTSW	7	28153308	missense	probably benign	0.09
R5326:9530053A07Rik	UTSW	7	28155489	missense	probably damaging	0.98
R5396:9530053A07Rik	UTSW	7	28140183	missense	probably benign
R5441:9530053A07Rik	UTSW	7	28156914	missense	probably damaging	1.00
R5480:9530053A07Rik	UTSW	7	28157999	nonsense	probably null
R5542:9530053A07Rik	UTSW	7	28155489	missense	probably damaging	0.98
R5571:9530053A07Rik	UTSW	7	28156569	missense	probably damaging	0.99
R5613:9530053A07Rik	UTSW	7	28142878	intron	probably benign
R5637:9530053A07Rik	UTSW	7	28152852	missense	probably benign	0.00
R5766:9530053A07Rik	UTSW	7	28137329	nonsense	probably null
R6174:9530053A07Rik	UTSW	7	28139959	missense	probably damaging	0.96
R6233:9530053A07Rik	UTSW	7	28131460	missense	probably damaging	0.99
R6250:9530053A07Rik	UTSW	7	28150714	missense	probably damaging	1.00
R6379:9530053A07Rik	UTSW	7	28157592	missense	probably damaging	1.00
R6442:9530053A07Rik	UTSW	7	28144186	missense	possibly damaging	0.88
R6478:9530053A07Rik	UTSW	7	28155373	missense	probably damaging	1.00
R6699:9530053A07Rik	UTSW	7	28144368	missense	probably damaging	1.00
R6852:9530053A07Rik	UTSW	7	28147135	missense	probably damaging	1.00
R6883:9530053A07Rik	UTSW	7	28152835	missense	possibly damaging	0.89
R6902:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6903:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6904:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6992:9530053A07Rik	UTSW	7	28140183	missense	probably benign	0.04
R7023:9530053A07Rik	UTSW	7	28140038	nonsense	probably null
R7039:9530053A07Rik	UTSW	7	28140148	missense	possibly damaging	0.80
R7171:9530053A07Rik	UTSW	7	28154519	nonsense	probably null
R7282:9530053A07Rik	UTSW	7	28144408	missense	probably benign	0.02
R7291:9530053A07Rik	UTSW	7	28140220	missense	probably benign
R7344:9530053A07Rik	UTSW	7	28140279	missense	possibly damaging	0.79
R7344:9530053A07Rik	UTSW	7	28152760	missense	possibly damaging	0.46
R7392:9530053A07Rik	UTSW	7	28164372	missense	possibly damaging	0.83
R7531:9530053A07Rik	UTSW	7	28140231	missense	probably benign
R7541:9530053A07Rik	UTSW	7	28144256	nonsense	probably null
R7577:9530053A07Rik	UTSW	7	28154423	missense	possibly damaging	0.65
R7594:9530053A07Rik	UTSW	7	28131460	missense	probably damaging	0.99
R7647:9530053A07Rik	UTSW	7	28140045	missense	probably benign	0.00
R7718:9530053A07Rik	UTSW	7	28147201	missense	probably damaging	1.00
R7733:9530053A07Rik	UTSW	7	28139965	missense	probably damaging	1.00
R7737:9530053A07Rik	UTSW	7	28157073	missense	probably damaging	1.00
R7908:9530053A07Rik	UTSW	7	28147496	missense	probably benign	0.12
R8013:9530053A07Rik	UTSW	7	28137541	missense	probably benign	0.14
R8014:9530053A07Rik	UTSW	7	28137541	missense	probably benign	0.14
R8151:9530053A07Rik	UTSW	7	28153341	missense	possibly damaging	0.95
R8175:9530053A07Rik	UTSW	7	28164448	nonsense	probably null
R8254:9530053A07Rik	UTSW	7	28147349	missense	possibly damaging	0.63
R8345:9530053A07Rik	UTSW	7	28155360	missense	probably damaging	1.00
R8414:9530053A07Rik	UTSW	7	28142733	missense	probably damaging	1.00
R8419:9530053A07Rik	UTSW	7	28143921	missense	probably damaging	1.00
R8496:9530053A07Rik	UTSW	7	28143952	missense	possibly damaging	0.81
R8691:9530053A07Rik	UTSW	7	28153839	missense	possibly damaging	0.72
R8785:9530053A07Rik	UTSW	7	28154707	missense	probably damaging	1.00
R8863:9530053A07Rik	UTSW	7	28131581	missense	probably damaging	1.00
R8926:9530053A07Rik	UTSW	7	28154444	missense	probably damaging	1.00
R8950:9530053A07Rik	UTSW	7	28164326	missense	probably benign	0.32
R9014:9530053A07Rik	UTSW	7	28155451	missense	probably damaging	1.00
R9045:9530053A07Rik	UTSW	7	28154431	missense	probably damaging	1.00
R9115:9530053A07Rik	UTSW	7	28154329	missense	possibly damaging	0.74
R9233:9530053A07Rik	UTSW	7	28140094	missense	possibly damaging	0.83
R9330:9530053A07Rik	UTSW	7	28156985	missense	probably benign	0.02
R9426:9530053A07Rik	UTSW	7	28143856	missense	possibly damaging	0.92
R9477:9530053A07Rik	UTSW	7	28152840	missense	probably damaging	1.00
R9502:9530053A07Rik	UTSW	7	28137466	missense	probably benign	0.09
R9505:9530053A07Rik	UTSW	7	28142484	nonsense	probably null
R9601:9530053A07Rik	UTSW	7	28154380	missense	possibly damaging	0.78
R9630:9530053A07Rik	UTSW	7	28137199	missense	probably damaging	1.00
R9632:9530053A07Rik	UTSW	7	28142301	missense	probably benign
R9673:9530053A07Rik	UTSW	7	28156619	missense	probably benign	0.25
R9735:9530053A07Rik	UTSW	7	28157010	missense	probably damaging	1.00
Z1176:9530053A07Rik	UTSW	7	28142386	missense	probably benign	0.06
Z1176:9530053A07Rik	UTSW	7	28154762	missense	probably benign	0.03
Z1177:9530053A07Rik	UTSW	7	28139898	missense	probably benign	0.25
Z1186:9530053A07Rik	UTSW	7	28131572	missense	probably benign
Z1186:9530053A07Rik	UTSW	7	28146705	missense	probably benign	0.00
Z1186:9530053A07Rik	UTSW	7	28156986	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGGCAACTGTCCGTCTTGCATC -3'
(R):5'- CCTCTTGTGGCAACCTCAATCACTG -3'

Sequencing Primer
(F):5'- GTCTTGCATCCCAAGCCAG -3'
(R):5'- GCAACCTCAATCACTGTGGTC -3'

Posted On

2013-04-11