Incidental Mutation 'R1981:Cyp2c29'
ID222417
Institutional Source Beutler Lab
Gene Symbol Cyp2c29
Ensembl Gene ENSMUSG00000003053
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 29
SynonymsAh-2, Cyp2c, P450-2C, Ahh-1, AHOHase, AHOH
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1981 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39269405-39330713 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 39307772 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003137] [ENSMUST00000176624] [ENSMUST00000177087]
Predicted Effect probably null
Transcript: ENSMUST00000003137
SMART Domains Protein: ENSMUSP00000003137
Gene: ENSMUSG00000003053

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:p450 30 487 5.4e-165 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176624
SMART Domains Protein: ENSMUSP00000135863
Gene: ENSMUSG00000003053

DomainStartEndE-ValueType
Pfam:p450 12 448 2.7e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177087
SMART Domains Protein: ENSMUSP00000135839
Gene: ENSMUSG00000003053

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:p450 30 118 8.4e-22 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Cyp2c29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cyp2c29 APN 19 39321699 splice site probably benign
IGL00482:Cyp2c29 APN 19 39325023 missense probably damaging 0.97
IGL00694:Cyp2c29 APN 19 39321635 missense possibly damaging 0.64
IGL00836:Cyp2c29 APN 19 39324990 missense probably damaging 0.98
IGL00858:Cyp2c29 APN 19 39307656 missense probably damaging 1.00
IGL01350:Cyp2c29 APN 19 39330327 missense probably damaging 1.00
IGL01455:Cyp2c29 APN 19 39329117 missense possibly damaging 0.89
IGL01718:Cyp2c29 APN 19 39330260 missense possibly damaging 0.48
IGL01977:Cyp2c29 APN 19 39290897 splice site probably benign
IGL01991:Cyp2c29 APN 19 39330315 missense probably damaging 1.00
IGL02097:Cyp2c29 APN 19 39307620 missense probably damaging 1.00
IGL02267:Cyp2c29 APN 19 39330422 missense probably benign 0.19
IGL02451:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02452:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02548:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02549:Cyp2c29 APN 19 39309785 missense possibly damaging 0.48
IGL02938:Cyp2c29 APN 19 39287123 missense probably damaging 0.99
IGL03252:Cyp2c29 APN 19 39287175 missense probably damaging 1.00
IGL03367:Cyp2c29 APN 19 39329215 missense probably damaging 0.97
H8562:Cyp2c29 UTSW 19 39309662 missense probably damaging 1.00
IGL03052:Cyp2c29 UTSW 19 39287218 missense possibly damaging 0.90
R0415:Cyp2c29 UTSW 19 39329095 splice site probably benign
R0504:Cyp2c29 UTSW 19 39309780 missense probably benign 0.29
R0690:Cyp2c29 UTSW 19 39309726 missense probably benign 0.00
R1531:Cyp2c29 UTSW 19 39324968 missense probably damaging 1.00
R1730:Cyp2c29 UTSW 19 39324945 missense possibly damaging 0.79
R2113:Cyp2c29 UTSW 19 39330264 missense probably damaging 1.00
R2220:Cyp2c29 UTSW 19 39287232 missense probably benign 0.09
R3873:Cyp2c29 UTSW 19 39329144 missense probably damaging 0.99
R4424:Cyp2c29 UTSW 19 39287176 missense probably damaging 0.98
R4451:Cyp2c29 UTSW 19 39290826 missense probably damaging 0.99
R4803:Cyp2c29 UTSW 19 39324995 missense probably benign 0.01
R5288:Cyp2c29 UTSW 19 39330372 missense probably damaging 0.96
R5474:Cyp2c29 UTSW 19 39324992 missense probably damaging 1.00
R5475:Cyp2c29 UTSW 19 39330287 missense possibly damaging 0.91
R5893:Cyp2c29 UTSW 19 39330389 missense possibly damaging 0.93
R5894:Cyp2c29 UTSW 19 39330389 missense possibly damaging 0.93
R6000:Cyp2c29 UTSW 19 39307606 critical splice acceptor site probably null
R6144:Cyp2c29 UTSW 19 39321609 missense possibly damaging 0.96
R6296:Cyp2c29 UTSW 19 39330261 missense possibly damaging 0.64
R6365:Cyp2c29 UTSW 19 39307754 missense probably damaging 1.00
R6449:Cyp2c29 UTSW 19 39290867 missense probably benign 0.05
R6464:Cyp2c29 UTSW 19 39329225 missense probably damaging 0.96
R6919:Cyp2c29 UTSW 19 39291141 missense probably benign 0.26
R6978:Cyp2c29 UTSW 19 39321663 missense probably damaging 1.00
R7038:Cyp2c29 UTSW 19 39287127 missense probably benign 0.01
R7040:Cyp2c29 UTSW 19 39330337 missense possibly damaging 0.95
R7391:Cyp2c29 UTSW 19 39307767 missense probably null 0.98
X0024:Cyp2c29 UTSW 19 39321599 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTAGCTGTTAGGAAAATTGTAGGC -3'
(R):5'- AGCCAACCTAGCCTTTGTCC -3'

Sequencing Primer
(F):5'- GTAGGCAAGATATGGTTTAAAACTCC -3'
(R):5'- GTCCTTCAGATTTTCTATTGGCATAG -3'
Posted On2014-08-25