Incidental Mutation 'R1981:Olfr1297'
ID222262
Institutional Source Beutler Lab
Gene Symbol Olfr1297
Ensembl Gene ENSMUSG00000094858
Gene Nameolfactory receptor 1297
SynonymsGA_x6K02T2Q125-72673494-72672556, MOR248-4
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1981 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111615233-111626497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111621241 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 278 (I278F)
Ref Sequence ENSEMBL: ENSMUSP00000150543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099612] [ENSMUST00000207283] [ENSMUST00000213398]
Predicted Effect probably benign
Transcript: ENSMUST00000099612
AA Change: I278F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097207
Gene: ENSMUSG00000094858
AA Change: I278F

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7tm_1 41 287 6.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207283
AA Change: I278F
Predicted Effect probably benign
Transcript: ENSMUST00000213398
AA Change: I278F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Olfr1297
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr1297 APN 2 111621340 missense probably damaging 1.00
IGL01305:Olfr1297 APN 2 111621201 missense probably damaging 1.00
IGL01903:Olfr1297 APN 2 111621658 missense probably benign 0.01
IGL01984:Olfr1297 APN 2 111621582 missense probably benign 0.34
IGL03065:Olfr1297 APN 2 111621190 missense probably damaging 0.98
ANU22:Olfr1297 UTSW 2 111621201 missense probably damaging 1.00
R0313:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R0615:Olfr1297 UTSW 2 111621919 missense possibly damaging 0.95
R1028:Olfr1297 UTSW 2 111621525 missense probably damaging 1.00
R1078:Olfr1297 UTSW 2 111621345 missense probably damaging 1.00
R1158:Olfr1297 UTSW 2 111621741 missense probably damaging 1.00
R1419:Olfr1297 UTSW 2 111621295 missense probably benign 0.05
R1980:Olfr1297 UTSW 2 111621241 missense probably benign 0.00
R2044:Olfr1297 UTSW 2 111621814 missense probably benign 0.02
R2080:Olfr1297 UTSW 2 111621739 missense probably benign
R2170:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R4494:Olfr1297 UTSW 2 111621148 nonsense probably null
R4965:Olfr1297 UTSW 2 111621534 missense probably damaging 1.00
R5175:Olfr1297 UTSW 2 111621426 missense possibly damaging 0.78
R5891:Olfr1297 UTSW 2 111621433 missense probably damaging 1.00
R6192:Olfr1297 UTSW 2 111621175 missense possibly damaging 0.91
R6383:Olfr1297 UTSW 2 111621186 missense probably benign 0.10
R6730:Olfr1297 UTSW 2 111621735 missense probably damaging 0.96
R7189:Olfr1297 UTSW 2 111621193 missense probably benign 0.03
R7193:Olfr1297 UTSW 2 111621255 missense probably damaging 1.00
R7199:Olfr1297 UTSW 2 111621193 missense probably benign 0.01
R7735:Olfr1297 UTSW 2 111621474 missense probably damaging 1.00
X0063:Olfr1297 UTSW 2 111621381 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GATTCACAATGACCTGATAGCTC -3'
(R):5'- AGCTAGCCTGCATGGATTCC -3'

Sequencing Primer
(F):5'- GCTCATCAGTAAATGCCATATTTTC -3'
(R):5'- GCATGGATTCCCAGGATTTAAATAC -3'
Posted On2014-08-25