Incidental Mutation 'R1981:Baz2b'
ID 222252
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Name bromodomain adjacent to zinc finger domain, 2B
Synonyms D2Ertd794e, 5830435C13Rik
MMRRC Submission 039993-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R1981 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 59729707-60040183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59754024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1100 (F1100L)
Ref Sequence ENSEMBL: ENSMUSP00000108169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550] [ENSMUST00000153136]
AlphaFold A2AUY4
Predicted Effect possibly damaging
Transcript: ENSMUST00000090925
AA Change: F1100L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: F1100L

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112550
AA Change: F1100L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: F1100L

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152639
Predicted Effect probably benign
Transcript: ENSMUST00000153136
SMART Domains Protein: ENSMUSP00000118981
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
coiled coil region 48 218 N/A INTRINSIC
Pfam:DDT 247 296 1.6e-13 PFAM
Meta Mutation Damage Score 0.6240 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks1 T C 17: 28,204,095 (GRCm39) V181A probably damaging Het
Aqp4 T C 18: 15,526,608 (GRCm39) D291G probably damaging Het
Atad1 G T 19: 32,673,210 (GRCm39) D224E probably benign Het
Atp1a3 T G 7: 24,700,400 (GRCm39) E33A probably benign Het
Car7 C T 8: 105,275,009 (GRCm39) probably benign Het
Casp8 C A 1: 58,868,121 (GRCm39) probably null Het
Cdh23 A T 10: 60,214,530 (GRCm39) L1495H probably damaging Het
Ceacam9 T G 7: 16,459,232 (GRCm39) L177R probably benign Het
Col16a1 C G 4: 129,959,236 (GRCm39) P346A unknown Het
Cyp2c29 A G 19: 39,296,216 (GRCm39) probably null Het
Cyp3a13 T C 5: 137,910,118 (GRCm39) S139G probably damaging Het
Dapk2 A G 9: 66,176,180 (GRCm39) H327R probably benign Het
Ddx19b T C 8: 111,735,975 (GRCm39) T357A possibly damaging Het
Dnah2 A G 11: 69,365,151 (GRCm39) Y1944H probably damaging Het
Dnai2 T A 11: 114,623,755 (GRCm39) V6E probably damaging Het
Eipr1 T C 12: 28,913,024 (GRCm39) Y242H probably damaging Het
Fam149a T G 8: 45,834,778 (GRCm39) D7A probably damaging Het
Fam217a T A 13: 35,100,737 (GRCm39) D140V probably benign Het
Fat4 G A 3: 39,045,813 (GRCm39) C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 (GRCm38) P261T probably benign Het
Gcsam A T 16: 45,440,337 (GRCm39) T127S probably damaging Het
Git2 C T 5: 114,887,620 (GRCm39) probably benign Het
Gm1527 T C 3: 28,969,984 (GRCm39) probably null Het
Gtf3c1 A G 7: 125,243,444 (GRCm39) L1720P possibly damaging Het
H2-T9 T A 17: 36,439,614 (GRCm39) D122V probably damaging Het
Hat1 A G 2: 71,220,321 (GRCm39) T28A probably benign Het
Igf2r G A 17: 12,952,790 (GRCm39) Q219* probably null Het
Impdh1 T A 6: 29,206,450 (GRCm39) D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Ltbp3 A G 19: 5,808,107 (GRCm39) Q1250R probably benign Het
Mansc4 T A 6: 146,977,173 (GRCm39) I148F probably benign Het
Mast2 T C 4: 116,172,037 (GRCm39) Y569C probably damaging Het
Mcoln3 A T 3: 145,846,345 (GRCm39) K552* probably null Het
Mctp2 T C 7: 71,814,446 (GRCm39) Q601R probably benign Het
Mei1 A G 15: 81,987,513 (GRCm39) N859S probably benign Het
Myo19 A T 11: 84,782,996 (GRCm39) Q170L possibly damaging Het
Myo1h T C 5: 114,491,898 (GRCm39) F676S probably damaging Het
Myo9a A G 9: 59,801,429 (GRCm39) T1876A probably benign Het
Nav3 G T 10: 109,554,951 (GRCm39) probably benign Het
Ndor1 T C 2: 25,145,236 (GRCm39) Y43C probably damaging Het
Nlrp1a A G 11: 70,989,764 (GRCm39) V1102A probably damaging Het
Nmnat3 T C 9: 98,292,352 (GRCm39) I199T possibly damaging Het
Nsun7 T C 5: 66,418,557 (GRCm39) S96P probably damaging Het
Ntng1 A G 3: 109,842,326 (GRCm39) V149A possibly damaging Het
Oas3 T C 5: 120,899,900 (GRCm39) probably benign Het
Or10v9 T G 19: 11,832,371 (GRCm39) Q315H possibly damaging Het
Or4k47 T A 2: 111,451,586 (GRCm39) I278F probably benign Het
Or5bw2 A G 7: 6,573,557 (GRCm39) D189G probably benign Het
Or6z7 T C 7: 6,483,931 (GRCm39) M75V probably benign Het
Or8b3 T C 9: 38,315,031 (GRCm39) L287P probably damaging Het
Or8k53 A T 2: 86,177,486 (GRCm39) I208N possibly damaging Het
Pax2 G A 19: 44,806,904 (GRCm39) D301N probably damaging Het
Pcsk4 T A 10: 80,161,613 (GRCm39) E176V probably damaging Het
Pkhd1 G A 1: 20,187,284 (GRCm39) P3675S probably benign Het
Plekho2 A T 9: 65,465,974 (GRCm39) L138Q probably damaging Het
Ppp4r3c1 A T X: 88,975,051 (GRCm39) V382E probably damaging Het
Prkcsh A G 9: 21,924,164 (GRCm39) D458G probably damaging Het
Prr11 T A 11: 86,994,116 (GRCm39) D100V probably damaging Het
Qars1 A G 9: 108,392,227 (GRCm39) N136D probably damaging Het
Rbm15b A G 9: 106,758,822 (GRCm39) probably benign Het
Rel C T 11: 23,692,761 (GRCm39) G424D probably benign Het
Rsrc1 A G 3: 67,257,338 (GRCm39) D250G probably benign Het
Samt3 A C X: 85,090,740 (GRCm39) M211L probably benign Het
Scn2a C A 2: 65,520,514 (GRCm39) N503K probably damaging Het
Sh2d6 G A 6: 72,494,527 (GRCm39) probably benign Het
Smg8 T C 11: 86,976,157 (GRCm39) T475A probably benign Het
Ssxb10 A G X: 8,197,258 (GRCm39) D77G probably benign Het
Tbx20 T A 9: 24,682,209 (GRCm39) K48N possibly damaging Het
Tead1 C A 7: 112,490,952 (GRCm39) D231E probably benign Het
Ticam1 C T 17: 56,578,555 (GRCm39) R180H probably damaging Het
Tjp1 A T 7: 64,962,603 (GRCm39) F1111L probably damaging Het
Tlr11 T A 14: 50,599,445 (GRCm39) I477K possibly damaging Het
Ttc13 A G 8: 125,440,926 (GRCm39) probably null Het
Ttc17 T C 2: 94,157,049 (GRCm39) N411S probably benign Het
Usp15 T A 10: 122,960,946 (GRCm39) probably benign Het
Usp18 A G 6: 121,229,476 (GRCm39) K32E probably benign Het
Vmn1r12 A T 6: 57,136,646 (GRCm39) M248L probably benign Het
Zbtb14 C A 17: 69,695,497 (GRCm39) F398L probably damaging Het
Zfp930 T A 8: 69,680,824 (GRCm39) L172H probably damaging Het
Zfp976 G A 7: 42,263,046 (GRCm39) H264Y probably damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59,743,139 (GRCm39) missense probably benign 0.02
IGL00476:Baz2b APN 2 59,744,083 (GRCm39) missense probably benign 0.06
IGL00489:Baz2b APN 2 59,788,019 (GRCm39) nonsense probably null
IGL00514:Baz2b APN 2 59,792,821 (GRCm39) missense probably benign 0.11
IGL00678:Baz2b APN 2 59,836,527 (GRCm39) missense unknown
IGL01348:Baz2b APN 2 59,764,031 (GRCm39) missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59,799,233 (GRCm39) missense probably benign 0.18
IGL01924:Baz2b APN 2 59,765,615 (GRCm39) missense probably damaging 1.00
IGL02125:Baz2b APN 2 59,798,984 (GRCm39) missense probably benign 0.12
IGL02314:Baz2b APN 2 59,792,571 (GRCm39) missense probably benign
IGL02370:Baz2b APN 2 59,753,933 (GRCm39) missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59,790,407 (GRCm39) missense probably benign 0.40
IGL02499:Baz2b APN 2 59,731,840 (GRCm39) missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59,747,713 (GRCm39) missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59,778,604 (GRCm39) missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59,747,849 (GRCm39) unclassified probably benign
IGL02716:Baz2b APN 2 59,792,868 (GRCm39) missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59,807,718 (GRCm39) missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59,799,002 (GRCm39) missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59,807,872 (GRCm39) missense probably benign 0.00
IGL02886:Baz2b APN 2 59,788,087 (GRCm39) splice site probably null
IGL02892:Baz2b APN 2 59,731,080 (GRCm39) missense probably damaging 1.00
IGL03132:Baz2b APN 2 59,738,097 (GRCm39) splice site probably benign
IGL03183:Baz2b APN 2 59,733,640 (GRCm39) missense probably benign 0.10
IGL03197:Baz2b APN 2 59,731,898 (GRCm39) missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0122:Baz2b UTSW 2 59,743,963 (GRCm39) splice site probably null
R0136:Baz2b UTSW 2 59,732,298 (GRCm39) missense probably benign 0.22
R0144:Baz2b UTSW 2 59,737,839 (GRCm39) missense probably damaging 0.98
R0403:Baz2b UTSW 2 59,799,721 (GRCm39) missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59,732,340 (GRCm39) unclassified probably benign
R0528:Baz2b UTSW 2 59,767,083 (GRCm39) missense probably damaging 1.00
R1025:Baz2b UTSW 2 59,792,826 (GRCm39) missense probably benign 0.06
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59,752,553 (GRCm39) missense probably damaging 1.00
R1511:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R1514:Baz2b UTSW 2 59,792,670 (GRCm39) missense probably benign 0.13
R1519:Baz2b UTSW 2 59,778,598 (GRCm39) missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59,798,981 (GRCm39) missense possibly damaging 0.47
R1630:Baz2b UTSW 2 59,836,474 (GRCm39) missense unknown
R1641:Baz2b UTSW 2 59,743,234 (GRCm39) missense probably damaging 0.99
R1674:Baz2b UTSW 2 59,743,336 (GRCm39) missense possibly damaging 0.53
R1778:Baz2b UTSW 2 59,836,480 (GRCm39) missense unknown
R1826:Baz2b UTSW 2 59,799,077 (GRCm39) missense probably benign 0.12
R1835:Baz2b UTSW 2 59,732,163 (GRCm39) missense probably benign 0.02
R1954:Baz2b UTSW 2 59,799,087 (GRCm39) missense probably benign 0.12
R2029:Baz2b UTSW 2 59,743,067 (GRCm39) unclassified probably benign
R2567:Baz2b UTSW 2 59,744,255 (GRCm39) missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59,743,348 (GRCm39) missense probably benign 0.27
R2848:Baz2b UTSW 2 59,755,010 (GRCm39) missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59,799,240 (GRCm39) missense probably benign 0.12
R3935:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59,742,917 (GRCm39) splice site probably null
R4182:Baz2b UTSW 2 59,928,801 (GRCm39) intron probably benign
R4255:Baz2b UTSW 2 59,750,916 (GRCm39) unclassified probably benign
R4359:Baz2b UTSW 2 59,731,957 (GRCm39) missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59,799,599 (GRCm39) missense probably benign 0.06
R4743:Baz2b UTSW 2 59,744,255 (GRCm39) missense probably benign 0.01
R4772:Baz2b UTSW 2 59,788,795 (GRCm39) missense probably damaging 0.96
R4858:Baz2b UTSW 2 59,738,087 (GRCm39) missense probably benign
R4868:Baz2b UTSW 2 59,755,226 (GRCm39) missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59,773,103 (GRCm39) splice site probably null
R4889:Baz2b UTSW 2 59,767,070 (GRCm39) missense probably damaging 1.00
R4890:Baz2b UTSW 2 59,756,383 (GRCm39) missense probably damaging 0.99
R4914:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R5027:Baz2b UTSW 2 59,928,988 (GRCm39) intron probably benign
R5031:Baz2b UTSW 2 59,743,151 (GRCm39) missense probably benign 0.00
R5082:Baz2b UTSW 2 59,731,835 (GRCm39) nonsense probably null
R5133:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R5276:Baz2b UTSW 2 59,792,958 (GRCm39) missense probably benign 0.40
R5279:Baz2b UTSW 2 59,762,496 (GRCm39) missense probably damaging 1.00
R5294:Baz2b UTSW 2 59,808,946 (GRCm39) missense probably benign 0.11
R5447:Baz2b UTSW 2 59,744,332 (GRCm39) missense probably damaging 0.99
R5903:Baz2b UTSW 2 59,790,233 (GRCm39) missense probably damaging 0.99
R5910:Baz2b UTSW 2 59,807,770 (GRCm39) missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59,742,871 (GRCm39) missense probably damaging 0.99
R6195:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59,809,019 (GRCm39) missense probably benign 0.00
R6208:Baz2b UTSW 2 59,755,150 (GRCm39) missense probably damaging 1.00
R6233:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59,778,567 (GRCm39) missense probably damaging 1.00
R6324:Baz2b UTSW 2 59,737,292 (GRCm39) missense probably damaging 1.00
R6490:Baz2b UTSW 2 59,732,073 (GRCm39) missense probably damaging 1.00
R6578:Baz2b UTSW 2 59,799,623 (GRCm39) missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59,755,234 (GRCm39) missense probably damaging 1.00
R6760:Baz2b UTSW 2 59,792,776 (GRCm39) missense probably benign 0.40
R6836:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R6859:Baz2b UTSW 2 59,731,874 (GRCm39) missense probably benign 0.01
R6880:Baz2b UTSW 2 59,743,283 (GRCm39) missense probably damaging 0.99
R6916:Baz2b UTSW 2 59,799,120 (GRCm39) missense probably benign
R6978:Baz2b UTSW 2 59,738,059 (GRCm39) missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59,764,014 (GRCm39) critical splice donor site probably null
R7112:Baz2b UTSW 2 59,792,528 (GRCm39) missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59,742,841 (GRCm39) missense
R7198:Baz2b UTSW 2 59,792,550 (GRCm39) missense probably benign 0.00
R7270:Baz2b UTSW 2 59,792,836 (GRCm39) missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59,750,781 (GRCm39) missense probably benign 0.17
R7464:Baz2b UTSW 2 59,807,792 (GRCm39) missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59,792,817 (GRCm39) missense probably benign 0.40
R7703:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R7850:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7851:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7988:Baz2b UTSW 2 59,792,485 (GRCm39) missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59,731,112 (GRCm39) missense probably damaging 1.00
R8084:Baz2b UTSW 2 59,792,580 (GRCm39) missense probably benign
R8343:Baz2b UTSW 2 59,731,858 (GRCm39) missense probably damaging 1.00
R8348:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8438:Baz2b UTSW 2 59,747,828 (GRCm39) nonsense probably null
R8448:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8511:Baz2b UTSW 2 59,732,158 (GRCm39) missense probably benign
R8893:Baz2b UTSW 2 59,755,149 (GRCm39) missense probably damaging 0.96
R8947:Baz2b UTSW 2 59,778,583 (GRCm39) missense probably benign 0.06
R8998:Baz2b UTSW 2 59,799,608 (GRCm39) missense probably benign 0.02
R9241:Baz2b UTSW 2 59,743,993 (GRCm39) missense probably benign 0.01
R9245:Baz2b UTSW 2 59,743,331 (GRCm39) missense probably benign
R9577:Baz2b UTSW 2 59,809,031 (GRCm39) missense probably benign 0.06
R9581:Baz2b UTSW 2 59,799,300 (GRCm39) missense probably benign
R9601:Baz2b UTSW 2 59,731,847 (GRCm39) missense possibly damaging 0.66
R9613:Baz2b UTSW 2 59,731,824 (GRCm39) missense probably benign 0.09
R9639:Baz2b UTSW 2 59,731,828 (GRCm39) missense probably benign 0.01
X0011:Baz2b UTSW 2 59,807,705 (GRCm39) missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59,731,019 (GRCm39) missense probably damaging 1.00
X0064:Baz2b UTSW 2 59,799,626 (GRCm39) missense probably benign
Z1088:Baz2b UTSW 2 59,790,359 (GRCm39) missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59,807,864 (GRCm39) missense probably benign 0.01
Z1188:Baz2b UTSW 2 59,807,749 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCTTCAAAACAGGAACGAGC -3'
(R):5'- GCTTAACAAGGGCACAGAAC -3'

Sequencing Primer
(F):5'- GGAACGAGCTCACTTACCTC -3'
(R):5'- TCCACTCCAAATCTGTGATAAAGTC -3'
Posted On 2014-08-25