Incidental Mutation 'R1981:Baz2b'
ID 222252
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Name bromodomain adjacent to zinc finger domain, 2B
Synonyms D2Ertd794e, 5830435C13Rik
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock # R1981 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 59899363-60209839 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59923680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1100 (F1100L)
Ref Sequence ENSEMBL: ENSMUSP00000108169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550] [ENSMUST00000153136]
AlphaFold A2AUY4
Predicted Effect possibly damaging
Transcript: ENSMUST00000090925
AA Change: F1100L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: F1100L

low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112550
AA Change: F1100L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: F1100L

low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152639
Predicted Effect probably benign
Transcript: ENSMUST00000153136
SMART Domains Protein: ENSMUSP00000118981
Gene: ENSMUSG00000026987

coiled coil region 48 218 N/A INTRINSIC
Pfam:DDT 247 296 1.6e-13 PFAM
Meta Mutation Damage Score 0.6240 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S probably benign Het
Usp15 T A 10: 123,125,041 probably benign Het
Usp18 A G 6: 121,252,517 K32E probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0122:Baz2b UTSW 2 59913619 splice site probably null
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59901996 unclassified probably benign
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1025:Baz2b UTSW 2 59962482 missense probably benign 0.06
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1674:Baz2b UTSW 2 59912992 missense possibly damaging 0.53
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 splice site probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4858:Baz2b UTSW 2 59907743 missense probably benign
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4914:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
R7198:Baz2b UTSW 2 59962206 missense probably benign 0.00
R7270:Baz2b UTSW 2 59962492 missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59920437 missense probably benign 0.17
R7464:Baz2b UTSW 2 59977448 missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59962473 missense probably benign 0.40
R7703:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R7850:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7851:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7988:Baz2b UTSW 2 59962141 missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59900768 missense probably damaging 1.00
R8084:Baz2b UTSW 2 59962236 missense probably benign
R8343:Baz2b UTSW 2 59901514 missense probably damaging 1.00
R8348:Baz2b UTSW 2 59911793 missense
R8438:Baz2b UTSW 2 59917484 nonsense probably null
R8448:Baz2b UTSW 2 59911793 missense
R8511:Baz2b UTSW 2 59901814 missense probably benign
R8893:Baz2b UTSW 2 59924805 missense probably damaging 0.96
R8947:Baz2b UTSW 2 59948239 missense probably benign 0.06
R8998:Baz2b UTSW 2 59969264 missense probably benign 0.02
R9241:Baz2b UTSW 2 59913649 missense probably benign 0.01
R9245:Baz2b UTSW 2 59912987 missense probably benign
R9577:Baz2b UTSW 2 59978687 missense probably benign 0.06
R9581:Baz2b UTSW 2 59968956 missense probably benign
R9613:Baz2b UTSW 2 59901480 missense probably benign 0.09
R9639:Baz2b UTSW 2 59901484 missense probably benign 0.01
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59977520 missense probably benign 0.01
Z1188:Baz2b UTSW 2 59977405 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-08-25