Incidental Mutation 'R2001:Rab3gap1'
ID225880
Institutional Source Beutler Lab
Gene Symbol Rab3gap1
Ensembl Gene ENSMUSG00000036104
Gene NameRAB3 GTPase activating protein subunit 1
Synonyms1700003B17Rik, p130, 4732493F09Rik
MMRRC Submission 040011-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R2001 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location127868773-127943868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127903719 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 177 (Y177C)
Ref Sequence ENSEMBL: ENSMUSP00000148357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037649] [ENSMUST00000212506]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037649
AA Change: Y177C

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042070
Gene: ENSMUSG00000036104
AA Change: Y177C

DomainStartEndE-ValueType
low complexity region 254 263 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
Pfam:Rab3-GTPase_cat 612 769 2.9e-67 PFAM
low complexity region 856 868 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150945
Predicted Effect possibly damaging
Transcript: ENSMUST00000212506
AA Change: Y177C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of a Rab GTPase activating protein. The encoded protein forms a heterodimer with a non-catalytic subunit to specifically regulate the activity of members of the Rab3 subfamily of small G proteins. This protein mediates the hydrolysis of GTP bound Rab3 to the GDP bound form. Mutations in this gene are associated with Warburg micro syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal synaptic transmission but have normal gross brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,741,456 S559P probably benign Het
A430005L14Rik T A 4: 153,959,857 C42S probably damaging Het
Abca13 A T 11: 9,273,967 T449S probably benign Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Adamts13 C T 2: 26,973,990 P60L probably benign Het
Adamts20 T C 15: 94,347,718 T568A possibly damaging Het
Ago1 T C 4: 126,454,394 I44V probably null Het
Agtpbp1 TGAAGATGCATCTTGAGAAGA TGAAGA 13: 59,475,803 probably null Het
Ankrd28 A T 14: 31,745,336 V39E possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Asna1 T C 8: 85,025,160 S36G probably damaging Het
Astn1 A G 1: 158,520,521 N506D probably damaging Het
BC051019 G A 7: 109,720,551 Q102* probably null Het
Bpifb5 A G 2: 154,233,279 T376A possibly damaging Het
Ccdc121 G T 1: 181,510,986 Q134K probably benign Het
Ccl20 ATT ATTT 1: 83,117,855 probably null Het
Ccl6 G T 11: 83,589,337 P68T possibly damaging Het
Cd300ld A T 11: 114,987,330 F119I probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Chkb C T 15: 89,428,766 G36E probably damaging Het
Col11a1 A G 3: 114,165,293 probably null Het
Ctla2b T C 13: 60,896,067 Y120C probably damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Cyp2a22 G A 7: 26,934,772 P319L probably damaging Het
Dcaf12 A C 4: 41,302,804 V117G probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dgki T C 6: 36,865,801 D923G possibly damaging Het
Dhx37 G T 5: 125,427,464 T345K probably damaging Het
Dhx9 A T 1: 153,456,111 Y1370* probably null Het
Dnah7b T C 1: 46,142,087 S1045P possibly damaging Het
Dnmbp G C 19: 43,850,173 T1071S possibly damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Dst A T 1: 34,184,063 E1625D probably damaging Het
Egflam T A 15: 7,242,567 H630L probably benign Het
Elane T C 10: 79,887,759 V186A possibly damaging Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gfra1 A G 19: 58,300,275 L246P probably damaging Het
Gm14139 T A 2: 150,192,947 M396K probably benign Het
Gria2 T C 3: 80,710,805 T308A probably benign Het
Grip2 A T 6: 91,779,850 V540D probably benign Het
Hhipl1 A T 12: 108,321,859 I575F possibly damaging Het
Hmcn1 T A 1: 150,738,613 E1347D possibly damaging Het
Itga2b C A 11: 102,467,339 A187S probably benign Het
Kalrn C A 16: 34,028,045 R469M probably damaging Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lck T C 4: 129,548,937 N475S probably benign Het
Leng8 A G 7: 4,145,074 N642S probably damaging Het
Lingo4 T A 3: 94,403,075 I440N probably damaging Het
Lrrc4 A G 6: 28,830,905 F237S probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Naip2 A T 13: 100,144,588 I1316N probably damaging Het
Naip6 C T 13: 100,300,729 G429S probably benign Het
Noct C T 3: 51,248,044 R78C probably damaging Het
Npbwr1 A G 1: 5,917,175 V40A possibly damaging Het
Nsd2 A G 5: 33,843,402 N88D probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr389 T A 11: 73,776,713 I205F probably benign Het
Olfr800 T A 10: 129,660,421 I205N probably benign Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pard3 C T 8: 127,064,347 probably null Het
Pde4c A G 8: 70,747,358 probably null Het
Pde6h T A 6: 136,963,205 I63N probably damaging Het
Phldb2 T C 16: 45,774,195 K916E possibly damaging Het
Ppig T C 2: 69,741,644 S236P unknown Het
Ptprd T C 4: 75,954,122 Y1370C probably damaging Het
Pzp T C 6: 128,516,120 T352A probably benign Het
Rasgef1a G A 6: 118,089,196 V457M probably benign Het
Scel A T 14: 103,610,790 T616S possibly damaging Het
Sel1l A T 12: 91,826,550 Y228* probably null Het
Sgms1 A G 19: 32,159,683 V161A possibly damaging Het
Slfnl1 T C 4: 120,533,227 L25P probably benign Het
Smad5 A G 13: 56,737,374 T432A probably damaging Het
Sohlh2 T C 3: 55,192,341 probably null Het
Sphkap A T 1: 83,276,662 M835K probably damaging Het
Sqor A C 2: 122,798,098 T174P probably damaging Het
Stkld1 T C 2: 26,952,747 V577A probably damaging Het
Sulf2 T A 2: 166,080,853 E652D probably benign Het
Sycp2 T A 2: 178,378,055 Q556L probably benign Het
Syk A G 13: 52,611,238 T134A probably benign Het
Tas2r122 T A 6: 132,711,622 I103F possibly damaging Het
Tex10 A G 4: 48,451,940 W729R probably damaging Het
Tex261 G T 6: 83,773,731 P95T probably damaging Het
Tm2d2 T C 8: 25,017,507 S47P probably benign Het
Tmem2 A G 19: 21,801,987 D387G probably benign Het
Tmem95 A G 11: 69,876,991 S128P probably damaging Het
Tnxb G A 17: 34,692,579 A1619T possibly damaging Het
Trappc9 A G 15: 73,058,036 I157T probably damaging Het
Unc13c T A 9: 73,483,615 probably null Het
Upb1 A T 10: 75,429,969 Y210F probably damaging Het
Urb1 T C 16: 90,762,344 M1684V probably benign Het
Wnk2 G A 13: 49,078,682 P727S possibly damaging Het
Zfp551 A T 7: 12,416,349 S378T probably damaging Het
Zfp598 T C 17: 24,669,924 V56A possibly damaging Het
Zfp945 C T 17: 22,857,249 probably null Het
Other mutations in Rab3gap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rab3gap1 APN 1 127930387 splice site probably benign
IGL01467:Rab3gap1 APN 1 127930384 splice site probably null
IGL01554:Rab3gap1 APN 1 127928008 missense possibly damaging 0.82
IGL01773:Rab3gap1 APN 1 127918221 missense possibly damaging 0.64
IGL01866:Rab3gap1 APN 1 127891080 missense probably damaging 1.00
IGL02078:Rab3gap1 APN 1 127868915 splice site probably benign
IGL02251:Rab3gap1 APN 1 127937500 missense probably benign 0.25
IGL02268:Rab3gap1 APN 1 127868958 missense probably damaging 1.00
IGL02274:Rab3gap1 APN 1 127939080 missense probably benign
IGL02372:Rab3gap1 APN 1 127919561 splice site probably benign
IGL02399:Rab3gap1 APN 1 127928103 missense possibly damaging 0.93
IGL02629:Rab3gap1 APN 1 127909863 missense probably benign 0.01
IGL02700:Rab3gap1 APN 1 127938605 missense probably benign 0.06
IGL02748:Rab3gap1 APN 1 127937461 missense probably damaging 0.99
little_bighorn UTSW 1 127891098 critical splice donor site probably null
IGL03048:Rab3gap1 UTSW 1 127937477 missense probably damaging 1.00
R0828:Rab3gap1 UTSW 1 127938185 splice site probably benign
R1382:Rab3gap1 UTSW 1 127942596 missense probably damaging 0.97
R1729:Rab3gap1 UTSW 1 127942486 missense probably damaging 1.00
R1809:Rab3gap1 UTSW 1 127934514 missense probably damaging 0.99
R1990:Rab3gap1 UTSW 1 127942429 missense possibly damaging 0.56
R2041:Rab3gap1 UTSW 1 127937990 missense possibly damaging 0.78
R3955:Rab3gap1 UTSW 1 127934517 missense probably damaging 1.00
R4192:Rab3gap1 UTSW 1 127925470 intron probably benign
R4243:Rab3gap1 UTSW 1 127937567 critical splice donor site probably null
R4244:Rab3gap1 UTSW 1 127937567 critical splice donor site probably null
R4354:Rab3gap1 UTSW 1 127915641 missense probably benign 0.02
R4592:Rab3gap1 UTSW 1 127925259 intron probably benign
R4622:Rab3gap1 UTSW 1 127942419 missense probably benign 0.00
R4738:Rab3gap1 UTSW 1 127934436 missense probably damaging 0.99
R4917:Rab3gap1 UTSW 1 127889177 missense possibly damaging 0.75
R4918:Rab3gap1 UTSW 1 127889177 missense possibly damaging 0.75
R5090:Rab3gap1 UTSW 1 127915678 missense probably benign 0.35
R5197:Rab3gap1 UTSW 1 127889194 missense probably benign
R5310:Rab3gap1 UTSW 1 127942373 critical splice acceptor site probably null
R5580:Rab3gap1 UTSW 1 127930990 missense probably benign 0.01
R6670:Rab3gap1 UTSW 1 127930775 missense probably benign
R6825:Rab3gap1 UTSW 1 127930421 missense probably damaging 1.00
R7024:Rab3gap1 UTSW 1 127891098 critical splice donor site probably null
R7274:Rab3gap1 UTSW 1 127927512 missense probably benign
R7380:Rab3gap1 UTSW 1 127937990 missense possibly damaging 0.78
R7583:Rab3gap1 UTSW 1 127930875 missense probably benign 0.03
R7654:Rab3gap1 UTSW 1 127909915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAATCTGTATTCTTCCTATAGAG -3'
(R):5'- CAGATGCGTCCTCCTGAGTG -3'

Sequencing Primer
(F):5'- GAGTGAGCCTAATTTCTGCT -3'
(R):5'- GGAAGAACTGCTGAGTCATCTCTC -3'
Posted On2014-08-25