Incidental Mutation 'R4192:Rab3gap1'
ID318339
Institutional Source Beutler Lab
Gene Symbol Rab3gap1
Ensembl Gene ENSMUSG00000036104
Gene NameRAB3 GTPase activating protein subunit 1
Synonyms1700003B17Rik, p130, 4732493F09Rik
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location127868773-127943868 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 127925470 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037649] [ENSMUST00000212506]
Predicted Effect probably benign
Transcript: ENSMUST00000037649
SMART Domains Protein: ENSMUSP00000042070
Gene: ENSMUSG00000036104

DomainStartEndE-ValueType
low complexity region 254 263 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
Pfam:Rab3-GTPase_cat 612 769 2.9e-67 PFAM
low complexity region 856 868 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189259
Predicted Effect probably benign
Transcript: ENSMUST00000212506
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of a Rab GTPase activating protein. The encoded protein forms a heterodimer with a non-catalytic subunit to specifically regulate the activity of members of the Rab3 subfamily of small G proteins. This protein mediates the hydrolysis of GTP bound Rab3 to the GDP bound form. Mutations in this gene are associated with Warburg micro syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal synaptic transmission but have normal gross brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Rab3gap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rab3gap1 APN 1 127930387 splice site probably benign
IGL01467:Rab3gap1 APN 1 127930384 splice site probably null
IGL01554:Rab3gap1 APN 1 127928008 missense possibly damaging 0.82
IGL01773:Rab3gap1 APN 1 127918221 missense possibly damaging 0.64
IGL01866:Rab3gap1 APN 1 127891080 missense probably damaging 1.00
IGL02078:Rab3gap1 APN 1 127868915 splice site probably benign
IGL02251:Rab3gap1 APN 1 127937500 missense probably benign 0.25
IGL02268:Rab3gap1 APN 1 127868958 missense probably damaging 1.00
IGL02274:Rab3gap1 APN 1 127939080 missense probably benign
IGL02372:Rab3gap1 APN 1 127919561 splice site probably benign
IGL02399:Rab3gap1 APN 1 127928103 missense possibly damaging 0.93
IGL02629:Rab3gap1 APN 1 127909863 missense probably benign 0.01
IGL02700:Rab3gap1 APN 1 127938605 missense probably benign 0.06
IGL02748:Rab3gap1 APN 1 127937461 missense probably damaging 0.99
little_bighorn UTSW 1 127891098 critical splice donor site probably null
IGL03048:Rab3gap1 UTSW 1 127937477 missense probably damaging 1.00
R0828:Rab3gap1 UTSW 1 127938185 splice site probably benign
R1382:Rab3gap1 UTSW 1 127942596 missense probably damaging 0.97
R1729:Rab3gap1 UTSW 1 127942486 missense probably damaging 1.00
R1809:Rab3gap1 UTSW 1 127934514 missense probably damaging 0.99
R1990:Rab3gap1 UTSW 1 127942429 missense possibly damaging 0.56
R2001:Rab3gap1 UTSW 1 127903719 missense possibly damaging 0.95
R2041:Rab3gap1 UTSW 1 127937990 missense possibly damaging 0.78
R3955:Rab3gap1 UTSW 1 127934517 missense probably damaging 1.00
R4243:Rab3gap1 UTSW 1 127937567 critical splice donor site probably null
R4244:Rab3gap1 UTSW 1 127937567 critical splice donor site probably null
R4354:Rab3gap1 UTSW 1 127915641 missense probably benign 0.02
R4592:Rab3gap1 UTSW 1 127925259 intron probably benign
R4622:Rab3gap1 UTSW 1 127942419 missense probably benign 0.00
R4738:Rab3gap1 UTSW 1 127934436 missense probably damaging 0.99
R4917:Rab3gap1 UTSW 1 127889177 missense possibly damaging 0.75
R4918:Rab3gap1 UTSW 1 127889177 missense possibly damaging 0.75
R5090:Rab3gap1 UTSW 1 127915678 missense probably benign 0.35
R5197:Rab3gap1 UTSW 1 127889194 missense probably benign
R5310:Rab3gap1 UTSW 1 127942373 critical splice acceptor site probably null
R5580:Rab3gap1 UTSW 1 127930990 missense probably benign 0.01
R6670:Rab3gap1 UTSW 1 127930775 missense probably benign
R6825:Rab3gap1 UTSW 1 127930421 missense probably damaging 1.00
R7024:Rab3gap1 UTSW 1 127891098 critical splice donor site probably null
R7274:Rab3gap1 UTSW 1 127927512 missense probably benign
R7380:Rab3gap1 UTSW 1 127937990 missense possibly damaging 0.78
R7583:Rab3gap1 UTSW 1 127930875 missense probably benign 0.03
R7654:Rab3gap1 UTSW 1 127909915 missense probably damaging 1.00
R8309:Rab3gap1 UTSW 1 127909918 missense possibly damaging 0.82
R8392:Rab3gap1 UTSW 1 127938633 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAAACATGTGAATGTCATCAGC -3'
(R):5'- CCTGACTTCCACTGTGCATG -3'

Sequencing Primer
(F):5'- GTGAATGTCATCAGCTTATTGACAC -3'
(R):5'- ATGTTAGCACATGCGCGC -3'
Posted On2015-06-10