Incidental Mutation 'R4192:Rab3gap1'
ID 318339
Institutional Source Beutler Lab
Gene Symbol Rab3gap1
Ensembl Gene ENSMUSG00000036104
Gene Name RAB3 GTPase activating protein subunit 1
Synonyms 1700003B17Rik, 4732493F09Rik, p130
MMRRC Submission 041023-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.279) question?
Stock # R4192 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 127796510-127871605 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 127853207 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037649] [ENSMUST00000212506]
AlphaFold Q80UJ7
Predicted Effect probably benign
Transcript: ENSMUST00000037649
SMART Domains Protein: ENSMUSP00000042070
Gene: ENSMUSG00000036104

DomainStartEndE-ValueType
low complexity region 254 263 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
Pfam:Rab3-GTPase_cat 612 769 2.9e-67 PFAM
low complexity region 856 868 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189259
Predicted Effect probably benign
Transcript: ENSMUST00000212506
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of a Rab GTPase activating protein. The encoded protein forms a heterodimer with a non-catalytic subunit to specifically regulate the activity of members of the Rab3 subfamily of small G proteins. This protein mediates the hydrolysis of GTP bound Rab3 to the GDP bound form. Mutations in this gene are associated with Warburg micro syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal synaptic transmission but have normal gross brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 35,818,536 (GRCm39) R178L possibly damaging Het
Acot4 T C 12: 84,089,948 (GRCm39) probably benign Het
Add3 C A 19: 53,230,955 (GRCm39) D543E probably benign Het
Angpt4 A C 2: 151,785,238 (GRCm39) D418A probably benign Het
Ano8 A T 8: 71,935,936 (GRCm39) V260D probably damaging Het
Cfh C T 1: 140,030,454 (GRCm39) R860H possibly damaging Het
Csmd3 T C 15: 47,710,667 (GRCm39) D1536G probably damaging Het
Dnajb9 A T 12: 44,253,860 (GRCm39) D182E probably benign Het
Epb42 G T 2: 120,860,570 (GRCm39) probably null Het
Fam185a T A 5: 21,630,122 (GRCm39) probably benign Het
Fer1l6 A G 15: 58,518,998 (GRCm39) D1710G probably damaging Het
Gabra2 G A 5: 71,165,341 (GRCm39) P210S probably benign Het
Gm8369 C T 19: 11,479,596 (GRCm39) P9S probably damaging Het
Il17ra A G 6: 120,458,472 (GRCm39) D541G probably damaging Het
Ints4 T G 7: 97,156,940 (GRCm39) H337Q probably damaging Het
Itgam A G 7: 127,663,904 (GRCm39) T44A probably benign Het
Lyst C A 13: 13,915,098 (GRCm39) T3264N probably damaging Het
Macf1 A G 4: 123,366,835 (GRCm39) F1077S possibly damaging Het
Myo3a T A 2: 22,412,188 (GRCm39) F728I probably damaging Het
Nacad T C 11: 6,555,534 (GRCm39) E72G probably benign Het
Nkain3 G A 4: 20,485,003 (GRCm39) Q25* probably null Het
Oca2 T C 7: 55,946,997 (GRCm39) F342S probably damaging Het
Or10d1c T A 9: 38,894,313 (GRCm39) Q9L probably benign Het
Osbpl6 T A 2: 76,415,573 (GRCm39) L499Q probably damaging Het
Pcdhgb8 G C 18: 37,896,594 (GRCm39) D555H probably damaging Het
Peak1 A T 9: 56,166,025 (GRCm39) N634K probably damaging Het
Pitpnm3 T C 11: 71,942,785 (GRCm39) K818R possibly damaging Het
Rcc1l T C 5: 134,184,648 (GRCm39) T385A probably benign Het
Rrm2 T C 12: 24,758,377 (GRCm39) I11T probably benign Het
Scnn1b A G 7: 121,501,962 (GRCm39) T207A possibly damaging Het
Spata31f3 A T 4: 42,874,185 (GRCm39) probably benign Het
Syt12 T A 19: 4,497,709 (GRCm39) probably benign Het
Tmprss6 A T 15: 78,330,857 (GRCm39) probably null Het
Ttbk1 A T 17: 46,790,173 (GRCm39) C91S probably damaging Het
Ube2q2l T C 6: 136,378,435 (GRCm39) T132A probably benign Het
Vit A G 17: 78,894,255 (GRCm39) H219R probably benign Het
Vmn1r27 A C 6: 58,192,812 (GRCm39) I14R probably damaging Het
Other mutations in Rab3gap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rab3gap1 APN 1 127,858,124 (GRCm39) splice site probably benign
IGL01467:Rab3gap1 APN 1 127,858,121 (GRCm39) splice site probably null
IGL01554:Rab3gap1 APN 1 127,855,745 (GRCm39) missense possibly damaging 0.82
IGL01773:Rab3gap1 APN 1 127,845,958 (GRCm39) missense possibly damaging 0.64
IGL01866:Rab3gap1 APN 1 127,818,817 (GRCm39) missense probably damaging 1.00
IGL02078:Rab3gap1 APN 1 127,796,652 (GRCm39) splice site probably benign
IGL02251:Rab3gap1 APN 1 127,865,237 (GRCm39) missense probably benign 0.25
IGL02268:Rab3gap1 APN 1 127,796,695 (GRCm39) missense probably damaging 1.00
IGL02274:Rab3gap1 APN 1 127,866,817 (GRCm39) missense probably benign
IGL02372:Rab3gap1 APN 1 127,847,298 (GRCm39) splice site probably benign
IGL02399:Rab3gap1 APN 1 127,855,840 (GRCm39) missense possibly damaging 0.93
IGL02629:Rab3gap1 APN 1 127,837,600 (GRCm39) missense probably benign 0.01
IGL02700:Rab3gap1 APN 1 127,866,342 (GRCm39) missense probably benign 0.06
IGL02748:Rab3gap1 APN 1 127,865,198 (GRCm39) missense probably damaging 0.99
little_bighorn UTSW 1 127,818,835 (GRCm39) critical splice donor site probably null
IGL03048:Rab3gap1 UTSW 1 127,865,214 (GRCm39) missense probably damaging 1.00
R0828:Rab3gap1 UTSW 1 127,865,922 (GRCm39) splice site probably benign
R1382:Rab3gap1 UTSW 1 127,870,333 (GRCm39) missense probably damaging 0.97
R1729:Rab3gap1 UTSW 1 127,870,223 (GRCm39) missense probably damaging 1.00
R1809:Rab3gap1 UTSW 1 127,862,251 (GRCm39) missense probably damaging 0.99
R1990:Rab3gap1 UTSW 1 127,870,166 (GRCm39) missense possibly damaging 0.56
R2001:Rab3gap1 UTSW 1 127,831,456 (GRCm39) missense possibly damaging 0.95
R2041:Rab3gap1 UTSW 1 127,865,727 (GRCm39) missense possibly damaging 0.78
R3955:Rab3gap1 UTSW 1 127,862,254 (GRCm39) missense probably damaging 1.00
R4243:Rab3gap1 UTSW 1 127,865,304 (GRCm39) critical splice donor site probably null
R4244:Rab3gap1 UTSW 1 127,865,304 (GRCm39) critical splice donor site probably null
R4354:Rab3gap1 UTSW 1 127,843,378 (GRCm39) missense probably benign 0.02
R4592:Rab3gap1 UTSW 1 127,852,996 (GRCm39) intron probably benign
R4622:Rab3gap1 UTSW 1 127,870,156 (GRCm39) missense probably benign 0.00
R4738:Rab3gap1 UTSW 1 127,862,173 (GRCm39) missense probably damaging 0.99
R4917:Rab3gap1 UTSW 1 127,816,914 (GRCm39) missense possibly damaging 0.75
R4918:Rab3gap1 UTSW 1 127,816,914 (GRCm39) missense possibly damaging 0.75
R5090:Rab3gap1 UTSW 1 127,843,415 (GRCm39) missense probably benign 0.35
R5197:Rab3gap1 UTSW 1 127,816,931 (GRCm39) missense probably benign
R5310:Rab3gap1 UTSW 1 127,870,110 (GRCm39) critical splice acceptor site probably null
R5580:Rab3gap1 UTSW 1 127,858,727 (GRCm39) missense probably benign 0.01
R6670:Rab3gap1 UTSW 1 127,858,512 (GRCm39) missense probably benign
R6825:Rab3gap1 UTSW 1 127,858,158 (GRCm39) missense probably damaging 1.00
R7024:Rab3gap1 UTSW 1 127,818,835 (GRCm39) critical splice donor site probably null
R7274:Rab3gap1 UTSW 1 127,855,249 (GRCm39) missense probably benign
R7380:Rab3gap1 UTSW 1 127,865,727 (GRCm39) missense possibly damaging 0.78
R7583:Rab3gap1 UTSW 1 127,858,612 (GRCm39) missense probably benign 0.03
R7654:Rab3gap1 UTSW 1 127,837,652 (GRCm39) missense probably damaging 1.00
R8309:Rab3gap1 UTSW 1 127,837,655 (GRCm39) missense possibly damaging 0.82
R8392:Rab3gap1 UTSW 1 127,866,370 (GRCm39) missense probably benign 0.01
R8864:Rab3gap1 UTSW 1 127,837,630 (GRCm39) missense probably damaging 1.00
R9190:Rab3gap1 UTSW 1 127,858,495 (GRCm39) missense probably benign
R9799:Rab3gap1 UTSW 1 127,858,489 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAACATGTGAATGTCATCAGC -3'
(R):5'- CCTGACTTCCACTGTGCATG -3'

Sequencing Primer
(F):5'- GTGAATGTCATCAGCTTATTGACAC -3'
(R):5'- ATGTTAGCACATGCGCGC -3'
Posted On 2015-06-10