Mutagenetix > Incidental Mutation

Incidental Mutation 'R8864:Rab3gap1'

675796

Institutional Source

Beutler Lab

Gene Symbol

Rab3gap1

Ensembl Gene

ENSMUSG00000036104

Gene Name

RAB3 GTPase activating protein subunit 1

Synonyms

1700003B17Rik, p130, 4732493F09Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.264) question?

Stock #

R8864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127868773-127943868 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 127909893 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 231 (R231W)

Ref Sequence

ENSEMBL: ENSMUSP00000042070 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037649] [ENSMUST00000212506]

AlphaFold

Q80UJ7

Predicted Effect

probably damaging
Transcript: ENSMUST00000037649
AA Change: R231W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042070
Gene: ENSMUSG00000036104
AA Change: R231W

Domain	Start	End	E-Value	Type
low complexity region	254	263	N/A	INTRINSIC
low complexity region	574	587	N/A	INTRINSIC
Pfam:Rab3-GTPase_cat	612	769	2.9e-67	PFAM
low complexity region	856	868	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000212506
AA Change: R231W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of a Rab GTPase activating protein. The encoded protein forms a heterodimer with a non-catalytic subunit to specifically regulate the activity of members of the Rab3 subfamily of small G proteins. This protein mediates the hydrolysis of GTP bound Rab3 to the GDP bound form. Mutations in this gene are associated with Warburg micro syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal synaptic transmission but have normal gross brain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	T	A	18: 58,890,425	C297*	probably null	Het
Adamts3	T	C	5: 89,707,122		probably benign	Het
Best2	T	A	8: 85,009,313	M331L	probably benign	Het
Cachd1	T	A	4: 100,994,829	S1207R	probably damaging	Het
Cacna2d3	G	T	14: 29,333,778	N298K	probably damaging	Het
Cyp2j12	T	C	4: 96,121,513	Y203C	probably damaging	Het
Dnah8	T	C	17: 30,762,642	I3046T	possibly damaging	Het
Eif3b	T	C	5: 140,426,532	V252A	probably benign	Het
Ergic2	A	G	6: 148,181,895	V355A	probably benign	Het
F13a1	C	T	13: 36,877,779	G670D	probably damaging	Het
Gfpt1	T	A	6: 87,054,623	D82E	probably benign	Het
Ggnbp2	G	A	11: 84,840,076	R376C	probably damaging	Het
Gm30302	T	C	13: 49,787,512	N241D	probably benign	Het
Grn	T	C	11: 102,436,385	F191L	unknown	Het
Ighv1-16	C	T	12: 114,665,999	G56D	probably benign	Het
Jrkl	T	C	9: 13,244,321	D445G	probably benign	Het
Loxl3	A	G	6: 83,035,758	T93A	probably damaging	Het
Lrp1b	C	T	2: 41,112,706	A2094T		Het
Lrriq3	T	A	3: 155,187,938	D425E	probably damaging	Het
Majin	T	C	19: 6,211,620	V55A	possibly damaging	Het
Mapk8ip3	A	T	17: 24,899,518	V1192E	probably damaging	Het
Mdga1	T	C	17: 29,931,321	S106G	unknown	Het
Mtch2	C	T	2: 90,854,930	R135*	probably null	Het
Naip1	T	C	13: 100,426,320	N779S	possibly damaging	Het
Nfia	T	C	4: 98,063,145	V403A	possibly damaging	Het
Npas4	C	A	19: 4,988,528	D121Y	probably damaging	Het
Rangap1	C	G	15: 81,726,069		probably benign	Het
Rgs5	T	A	1: 169,690,421	F75I	probably benign	Het
Rnf19a	T	C	15: 36,265,306	D215G	possibly damaging	Het
Rwdd4a	A	T	8: 47,547,841		probably benign	Het
Setd5	G	A	6: 113,111,508	R199H	probably damaging	Het
Spef2	T	C	15: 9,599,747	Q2004R	unknown	Het
Syne1	T	C	10: 5,420,473	K236E	probably benign	Het
Tas2r104	A	G	6: 131,685,669	F26L	possibly damaging	Het
Tbc1d32	T	A	10: 56,087,559	E954D	probably benign	Het
Tenm2	A	C	11: 36,027,195	S1914A	possibly damaging	Het
Tln2	G	T	9: 67,330,552	Y32*	probably null	Het
Tnc	C	T	4: 63,993,059	R1425H	probably damaging	Het
Unc13b	T	C	4: 43,174,724	C1851R	unknown	Het
Wapl	T	A	14: 34,692,202	D340E	probably benign	Het
Zfp74	T	C	7: 29,934,810	E491G	probably damaging	Het

Other mutations in Rab3gap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01090:Rab3gap1	APN	1	127930387	splice site	probably benign
IGL01467:Rab3gap1	APN	1	127930384	splice site	probably null
IGL01554:Rab3gap1	APN	1	127928008	missense	possibly damaging	0.82
IGL01773:Rab3gap1	APN	1	127918221	missense	possibly damaging	0.64
IGL01866:Rab3gap1	APN	1	127891080	missense	probably damaging	1.00
IGL02078:Rab3gap1	APN	1	127868915	splice site	probably benign
IGL02251:Rab3gap1	APN	1	127937500	missense	probably benign	0.25
IGL02268:Rab3gap1	APN	1	127868958	missense	probably damaging	1.00
IGL02274:Rab3gap1	APN	1	127939080	missense	probably benign
IGL02372:Rab3gap1	APN	1	127919561	splice site	probably benign
IGL02399:Rab3gap1	APN	1	127928103	missense	possibly damaging	0.93
IGL02629:Rab3gap1	APN	1	127909863	missense	probably benign	0.01
IGL02700:Rab3gap1	APN	1	127938605	missense	probably benign	0.06
IGL02748:Rab3gap1	APN	1	127937461	missense	probably damaging	0.99
little_bighorn	UTSW	1	127891098	critical splice donor site	probably null
IGL03048:Rab3gap1	UTSW	1	127937477	missense	probably damaging	1.00
R0828:Rab3gap1	UTSW	1	127938185	splice site	probably benign
R1382:Rab3gap1	UTSW	1	127942596	missense	probably damaging	0.97
R1729:Rab3gap1	UTSW	1	127942486	missense	probably damaging	1.00
R1809:Rab3gap1	UTSW	1	127934514	missense	probably damaging	0.99
R1990:Rab3gap1	UTSW	1	127942429	missense	possibly damaging	0.56
R2001:Rab3gap1	UTSW	1	127903719	missense	possibly damaging	0.95
R2041:Rab3gap1	UTSW	1	127937990	missense	possibly damaging	0.78
R3955:Rab3gap1	UTSW	1	127934517	missense	probably damaging	1.00
R4192:Rab3gap1	UTSW	1	127925470	intron	probably benign
R4243:Rab3gap1	UTSW	1	127937567	critical splice donor site	probably null
R4244:Rab3gap1	UTSW	1	127937567	critical splice donor site	probably null
R4354:Rab3gap1	UTSW	1	127915641	missense	probably benign	0.02
R4592:Rab3gap1	UTSW	1	127925259	intron	probably benign
R4622:Rab3gap1	UTSW	1	127942419	missense	probably benign	0.00
R4738:Rab3gap1	UTSW	1	127934436	missense	probably damaging	0.99
R4917:Rab3gap1	UTSW	1	127889177	missense	possibly damaging	0.75
R4918:Rab3gap1	UTSW	1	127889177	missense	possibly damaging	0.75
R5090:Rab3gap1	UTSW	1	127915678	missense	probably benign	0.35
R5197:Rab3gap1	UTSW	1	127889194	missense	probably benign
R5310:Rab3gap1	UTSW	1	127942373	critical splice acceptor site	probably null
R5580:Rab3gap1	UTSW	1	127930990	missense	probably benign	0.01
R6670:Rab3gap1	UTSW	1	127930775	missense	probably benign
R6825:Rab3gap1	UTSW	1	127930421	missense	probably damaging	1.00
R7024:Rab3gap1	UTSW	1	127891098	critical splice donor site	probably null
R7274:Rab3gap1	UTSW	1	127927512	missense	probably benign
R7380:Rab3gap1	UTSW	1	127937990	missense	possibly damaging	0.78
R7583:Rab3gap1	UTSW	1	127930875	missense	probably benign	0.03
R7654:Rab3gap1	UTSW	1	127909915	missense	probably damaging	1.00
R8309:Rab3gap1	UTSW	1	127909918	missense	possibly damaging	0.82
R8392:Rab3gap1	UTSW	1	127938633	missense	probably benign	0.01
R9190:Rab3gap1	UTSW	1	127930758	missense	probably benign
R9799:Rab3gap1	UTSW	1	127930752	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAAGCTATACACAACTGGGTCAGTC -3'
(R):5'- AAAAGATGTGAGAGCTTTCTTCAGG -3'

Sequencing Primer
(F):5'- CTGAAGTTTTTAAACACAGGCT -3'
(R):5'- GGAATTCCTAGTATGAAACACC -3'

Posted On

2021-07-15