Incidental Mutation 'R2084:Slc6a5'
ID230202
Institutional Source Beutler Lab
Gene Symbol Slc6a5
Ensembl Gene ENSMUSG00000039728
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 5
SynonymsGlyt2
MMRRC Submission 040089-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2084 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location49910146-49963856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49948254 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 622 (M622K)
Ref Sequence ENSEMBL: ENSMUSP00000146917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056442] [ENSMUST00000107605] [ENSMUST00000207753] [ENSMUST00000209172]
Predicted Effect probably benign
Transcript: ENSMUST00000056442
AA Change: M622K

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000058699
Gene: ENSMUSG00000039728
AA Change: M622K

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107605
AA Change: M622K

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103230
Gene: ENSMUSG00000039728
AA Change: M622K

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207753
AA Change: M622K

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000209172
Meta Mutation Damage Score 0.3133 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium- and chloride-dependent glycine neurotransmitter transporter. This integral membrane glycoprotein is responsible for the clearance of extracellular glycine during glycine-mediated neurotransmission. This protein is found in glycinergic axons and maintains a high presynaptic pool of neurotransmitter at glycinergic synapses. Mutations in this gene cause hyperekplexia; a heterogenous neurological disorder characterized by exaggerated startle responses and neonatal apnea. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutant mice appear normal at birth but develop a complex neuromotor phenotype involving tremors, rigidity, and an impaired righting ability. Mutant mice die approximately 2 weeks after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T C 14: 8,558,171 D138G probably damaging Het
9530053A07Rik G A 7: 28,157,535 V2103M probably damaging Het
Ankrd36 C T 11: 5,662,378 Q1237* probably null Het
Aph1c T G 9: 66,819,297 R258S probably damaging Het
Arfgap3 T A 15: 83,334,566 N102I probably damaging Het
Astn1 T C 1: 158,472,408 V106A probably damaging Het
BC005537 G T 13: 24,812,715 probably null Het
Card10 G A 15: 78,792,971 T412M possibly damaging Het
Cars T C 7: 143,587,182 I126M probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Cpped1 T C 16: 11,828,501 D153G probably damaging Het
Cyp2j11 T A 4: 96,339,201 I193F probably damaging Het
Dnm2 T C 9: 21,500,371 probably null Het
Efemp1 A G 11: 28,915,763 D288G probably damaging Het
Espl1 T C 15: 102,296,851 probably null Het
Fcrl5 T C 3: 87,444,230 F262L probably benign Het
Gh G A 11: 106,301,132 P84L probably damaging Het
Gm10267 T C 18: 44,157,330 R37G probably benign Het
Gm13089 T A 4: 143,699,350 T8S probably damaging Het
Hmgxb3 C T 18: 61,155,023 probably benign Het
Ifit2 T C 19: 34,573,350 W97R probably damaging Het
Ift81 T G 5: 122,567,347 K491Q probably benign Het
Ints8 A G 4: 11,230,377 V488A probably benign Het
Krba1 T A 6: 48,414,568 L797Q probably damaging Het
Krr1 T C 10: 111,976,785 V100A probably damaging Het
Nav1 C T 1: 135,607,420 probably benign Het
Nos1 C A 5: 117,943,245 Q1205K probably damaging Het
Nup85 A T 11: 115,568,691 D125V possibly damaging Het
Olfr993 T C 2: 85,414,615 E88G probably benign Het
Pclo T G 5: 14,682,148 S3555A probably benign Het
Pdzrn3 T C 6: 101,154,295 I473V probably benign Het
Polr1a A G 6: 71,950,809 E848G possibly damaging Het
Pop1 T C 15: 34,508,598 probably benign Het
Prpf3 C T 3: 95,848,989 E117K probably benign Het
Psmg3 C T 5: 139,823,989 V101M probably benign Het
Rexo1 G A 10: 80,561,266 S52L probably benign Het
Ryk C T 9: 102,875,772 T210M probably damaging Het
Sde2 A G 1: 180,862,633 E306G probably damaging Het
Sec24c A G 14: 20,691,279 Q658R probably benign Het
Sgsm1 G A 5: 113,285,400 T183I probably damaging Het
Skint7 T A 4: 111,980,178 V51E probably damaging Het
Slco1a5 T C 6: 142,234,711 H655R probably benign Het
Slco1c1 T A 6: 141,559,852 Y452* probably null Het
Spn T C 7: 127,137,038 E99G probably benign Het
Ssc5d A G 7: 4,937,012 I789V probably benign Het
Taok2 G A 7: 126,870,191 T1155I probably benign Het
Tet2 T C 3: 133,487,767 Q302R possibly damaging Het
Trmt1l A G 1: 151,440,854 T189A probably damaging Het
Tubal3 T C 13: 3,928,192 I36T possibly damaging Het
Vmn2r71 A T 7: 85,618,737 Y133F probably benign Het
Vps11 G T 9: 44,353,261 H673N probably benign Het
Zc3h12a C T 4: 125,120,009 S354N probably benign Het
Zfp2 A G 11: 50,900,962 S85P probably benign Het
Other mutations in Slc6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Slc6a5 APN 7 49917733 missense probably benign 0.35
IGL01821:Slc6a5 APN 7 49914853 intron probably benign
R0084:Slc6a5 UTSW 7 49930013 missense probably benign 0.01
R0266:Slc6a5 UTSW 7 49938408 splice site probably benign
R0411:Slc6a5 UTSW 7 49911791 missense probably damaging 1.00
R0621:Slc6a5 UTSW 7 49917365 splice site probably null
R1649:Slc6a5 UTSW 7 49936262 missense probably damaging 1.00
R1822:Slc6a5 UTSW 7 49956425 missense probably benign 0.00
R1889:Slc6a5 UTSW 7 49951434 missense probably benign 0.03
R2098:Slc6a5 UTSW 7 49945567 missense probably damaging 1.00
R2365:Slc6a5 UTSW 7 49946536 missense possibly damaging 0.93
R2516:Slc6a5 UTSW 7 49956462 missense probably benign 0.00
R3622:Slc6a5 UTSW 7 49917623 missense probably benign 0.16
R3752:Slc6a5 UTSW 7 49936314 critical splice donor site probably null
R3848:Slc6a5 UTSW 7 49927558 splice site probably benign
R3917:Slc6a5 UTSW 7 49911869 missense probably damaging 1.00
R4617:Slc6a5 UTSW 7 49912020 missense probably benign 0.00
R4663:Slc6a5 UTSW 7 49938398 nonsense probably null
R4757:Slc6a5 UTSW 7 49959282 missense probably benign 0.15
R4916:Slc6a5 UTSW 7 49948256 missense probably benign 0.00
R5183:Slc6a5 UTSW 7 49936209 missense probably damaging 0.97
R5257:Slc6a5 UTSW 7 49929992 missense probably damaging 0.98
R5512:Slc6a5 UTSW 7 49941825 missense probably damaging 1.00
R5537:Slc6a5 UTSW 7 49959311 missense probably benign 0.03
R5558:Slc6a5 UTSW 7 49927573 missense probably benign
R5627:Slc6a5 UTSW 7 49911774 missense possibly damaging 0.85
R5655:Slc6a5 UTSW 7 49956470 missense probably benign
R5720:Slc6a5 UTSW 7 49956516 missense possibly damaging 0.86
R5736:Slc6a5 UTSW 7 49959354 missense probably benign 0.03
R5817:Slc6a5 UTSW 7 49956491 missense probably benign 0.00
R5879:Slc6a5 UTSW 7 49945512 missense probably damaging 1.00
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6072:Slc6a5 UTSW 7 49912195 missense probably damaging 1.00
R6157:Slc6a5 UTSW 7 49951502 missense probably benign 0.03
R6172:Slc6a5 UTSW 7 49948333 nonsense probably null
R6414:Slc6a5 UTSW 7 49910243 unclassified probably benign
R7348:Slc6a5 UTSW 7 49910167 unclassified probably benign
R7381:Slc6a5 UTSW 7 49930056 missense probably damaging 1.00
R7486:Slc6a5 UTSW 7 49917330 missense possibly damaging 0.81
R7624:Slc6a5 UTSW 7 49941866 missense probably benign 0.00
R7735:Slc6a5 UTSW 7 49948342 critical splice donor site probably null
R7760:Slc6a5 UTSW 7 49946617 missense probably benign 0.03
R8174:Slc6a5 UTSW 7 49948309 missense probably benign 0.39
R8219:Slc6a5 UTSW 7 49912163 missense probably benign
Z1088:Slc6a5 UTSW 7 49911857 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ACAAGTCTCCAGTTTACATGCC -3'
(R):5'- TCCTCACAGTGAATCTGAGGC -3'

Sequencing Primer
(F):5'- ACATGCCTTGTCCAGGTATAG -3'
(R):5'- TCACAGTGAATCTGAGGCAAGCTC -3'
Posted On2014-09-18