Incidental Mutation 'R2098:St8sia4'
ID230345
Institutional Source Beutler Lab
Gene Symbol St8sia4
Ensembl Gene ENSMUSG00000040710
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
SynonymsST8SiaIV, PST, Siat8d, PST-1
MMRRC Submission 040102-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2098 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location95587682-95667571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95653528 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 163 (H163R)
Ref Sequence ENSEMBL: ENSMUSP00000140534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043336] [ENSMUST00000189556]
Predicted Effect probably damaging
Transcript: ENSMUST00000043336
AA Change: H163R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043477
Gene: ENSMUSG00000040710
AA Change: H163R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_transf_29 94 354 2.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187936
Predicted Effect probably damaging
Transcript: ENSMUST00000189556
AA Change: H163R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140534
Gene: ENSMUSG00000040710
AA Change: H163R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Glyco_transf_29 90 266 2.2e-42 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null adult mice exhibit impaired long term potentiation and impaired long term depression in hippocampal CA1 synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,036,579 E1316G probably damaging Het
Arhgap32 C A 9: 32,259,911 T1329K probably damaging Het
Arhgef10l G C 4: 140,579,432 L104V probably damaging Het
Bend3 T C 10: 43,510,504 S298P probably damaging Het
Cacna1b C T 2: 24,650,546 V1385M probably damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Cd84 G A 1: 171,885,581 C291Y probably benign Het
Cdhr2 A G 13: 54,715,644 I113V probably benign Het
Cfap206 G A 4: 34,719,053 Q318* probably null Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cyth1 T A 11: 118,193,653 I25F probably damaging Het
D3Ertd254e T A 3: 36,166,140 S771T probably benign Het
Dock2 A T 11: 34,266,279 N1208K probably benign Het
Dock2 A G 11: 34,719,005 S203P probably damaging Het
Ehbp1l1 G T 19: 5,708,658 T1652K possibly damaging Het
Eps8l2 G A 7: 141,355,792 probably null Het
Gm10250 A G 15: 5,120,814 probably benign Het
Gm9772 T C 17: 22,006,637 H94R probably benign Het
Hspg2 G A 4: 137,520,109 G1184D probably damaging Het
Igfn1 T A 1: 135,978,305 D255V probably damaging Het
Marf1 T C 16: 14,114,200 H1651R probably benign Het
Mllt10 T C 2: 18,162,653 V385A possibly damaging Het
Mmp1b G A 9: 7,386,984 S76L probably benign Het
Mrps2 C A 2: 28,468,315 T39K probably benign Het
Myo6 T C 9: 80,281,526 Y715H probably damaging Het
Nsun7 A G 5: 66,283,712 E392G probably damaging Het
Obscn C T 11: 59,069,991 E3374K probably damaging Het
Oit1 T C 14: 8,361,479 I47V probably benign Het
Olfr1136 A T 2: 87,693,729 M51K probably benign Het
Olfr1206 A T 2: 88,864,871 I89F probably benign Het
Olfr434 G A 6: 43,217,503 V197I probably benign Het
Olfr684 A G 7: 105,157,271 V137A probably benign Het
Pkd2 C T 5: 104,478,902 P317S probably damaging Het
Prl5a1 T C 13: 28,145,505 S56P probably damaging Het
Psmd1 A G 1: 86,082,101 probably null Het
Ptchd3 T C 11: 121,842,479 C732R probably damaging Het
Rad51c A T 11: 87,402,763 V71E probably benign Het
Scn11a A T 9: 119,792,494 I619K possibly damaging Het
Sgpp1 T G 12: 75,716,510 D299A probably damaging Het
Slc16a4 C A 3: 107,300,847 Y224* probably null Het
Slc22a30 G A 19: 8,400,811 S167L probably damaging Het
Slc6a5 T C 7: 49,945,567 I559T probably damaging Het
Spire1 A G 18: 67,503,466 F364L probably damaging Het
Srek1 G A 13: 103,744,855 T421I unknown Het
Supt6 A G 11: 78,213,261 probably null Het
Tas2r103 T C 6: 133,036,597 T169A probably benign Het
Thrap3 A G 4: 126,180,030 S308P probably damaging Het
V1rd19 C T 7: 24,003,735 L209F probably damaging Het
Other mutations in St8sia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:St8sia4 APN 1 95653757 missense probably benign 0.19
IGL02109:St8sia4 APN 1 95660892 missense possibly damaging 0.68
IGL03117:St8sia4 APN 1 95591783 missense probably benign 0.12
IGL03280:St8sia4 APN 1 95653774 splice site probably benign
IGL03328:St8sia4 APN 1 95660870 missense probably benign 0.01
R0336:St8sia4 UTSW 1 95653558 missense probably benign 0.36
R0433:St8sia4 UTSW 1 95591704 missense probably damaging 0.97
R1217:St8sia4 UTSW 1 95653739 missense probably damaging 1.00
R1721:St8sia4 UTSW 1 95653669 missense probably damaging 0.99
R1752:St8sia4 UTSW 1 95591812 missense probably benign 0.32
R1891:St8sia4 UTSW 1 95591708 missense possibly damaging 0.93
R1909:St8sia4 UTSW 1 95627573 missense probably damaging 1.00
R2322:St8sia4 UTSW 1 95653738 missense probably damaging 1.00
R4094:St8sia4 UTSW 1 95627686 missense possibly damaging 0.53
R4365:St8sia4 UTSW 1 95591792 missense possibly damaging 0.89
R4852:St8sia4 UTSW 1 95660898 missense probably damaging 1.00
R4988:St8sia4 UTSW 1 95591797 missense possibly damaging 0.95
R5074:St8sia4 UTSW 1 95667185 missense probably benign 0.29
R5220:St8sia4 UTSW 1 95627735 missense probably damaging 0.97
R5611:St8sia4 UTSW 1 95627684 missense probably damaging 0.96
R5970:St8sia4 UTSW 1 95653582 missense probably damaging 1.00
R6027:St8sia4 UTSW 1 95653674 missense probably damaging 1.00
R6683:St8sia4 UTSW 1 95653699 missense probably damaging 1.00
R7498:St8sia4 UTSW 1 95591693 missense probably benign
R7937:St8sia4 UTSW 1 95653595 missense possibly damaging 0.56
X0063:St8sia4 UTSW 1 95591923 missense possibly damaging 0.92
Z1177:St8sia4 UTSW 1 95667456 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTGACAAGGTATTCGACTTTTC -3'
(R):5'- GTCATACACTATGTGCTGGACAG -3'

Sequencing Primer
(F):5'- CCACATAAATGGTGACGT -3'
(R):5'- ACTATGTGCTGGACAGACGCC -3'
Posted On2014-09-18