Incidental Mutation 'R2087:Epha1'
ID231514
Institutional Source Beutler Lab
Gene Symbol Epha1
Ensembl Gene ENSMUSG00000029859
Gene NameEph receptor A1
SynonymsEph, 5730453L17Rik, Esk
MMRRC Submission 040092-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R2087 (G1)
Quality Score91
Status Validated
Chromosome6
Chromosomal Location42358487-42373268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42363568 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 590 (D590N)
Ref Sequence ENSEMBL: ENSMUSP00000073099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073387] [ENSMUST00000164375] [ENSMUST00000204357]
PDB Structure
The solution structure of the second fibronectin type III domain of mouse Ephrin type-A receptor 1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000073387
AA Change: D590N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000073099
Gene: ENSMUSG00000029859
AA Change: D590N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 3.23e-103 SMART
FN3 334 430 8.43e-9 SMART
FN3 448 526 1.59e-4 SMART
Pfam:EphA2_TM 549 622 3.4e-13 PFAM
TyrKc 625 881 2.57e-126 SMART
SAM 911 977 4.13e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164375
SMART Domains Protein: ENSMUSP00000126622
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204238
Predicted Effect probably benign
Transcript: ENSMUST00000204357
AA Change: D627N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144763
Gene: ENSMUSG00000029859
AA Change: D627N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 1.1e-105 SMART
FN3 334 430 4.2e-11 SMART
low complexity region 459 473 N/A INTRINSIC
FN3 483 563 2.4e-8 SMART
Pfam:EphA2_TM 586 659 7.6e-11 PFAM
STYKc 662 849 1.1e-65 SMART
SAM 879 945 2.5e-21 SMART
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene is expressed in some human cancer cell lines and has been implicated in carcinogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a null allele exhibit a kinked tail while 18% of mice exhibit vagina atresia with hydrometrocolops and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021P04Rik T A 19: 24,065,000 noncoding transcript Het
Adamts8 G A 9: 30,962,112 R871Q probably damaging Het
Ank1 T C 8: 23,093,811 L310S probably damaging Het
Atp2a3 A G 11: 72,980,448 T592A probably damaging Het
Bpifb6 A G 2: 153,906,078 D219G possibly damaging Het
Catsper4 T C 4: 134,226,605 N81S probably damaging Het
Ccdc14 T C 16: 34,695,645 probably null Het
Ces1c A C 8: 93,107,602 N353K probably benign Het
Chrna6 T A 8: 27,407,127 M241L probably benign Het
Chtf8 T A 8: 106,885,936 R124* probably null Het
Cpt1b A G 15: 89,422,208 V296A probably benign Het
Cryl1 G A 14: 57,275,945 S273L possibly damaging Het
Ctps T C 4: 120,562,815 D134G probably benign Het
Cyp4f18 T C 8: 72,000,988 M138V probably benign Het
Dnajb12 A G 10: 59,890,845 K107R possibly damaging Het
Fndc3b A G 3: 27,451,554 V855A probably benign Het
Ganc A G 2: 120,457,257 Y822C probably damaging Het
Hook2 A G 8: 85,002,691 D622G probably damaging Het
Kcnj8 T A 6: 142,565,696 N395I probably benign Het
Kdm4b T C 17: 56,389,564 S427P possibly damaging Het
Krt12 A G 11: 99,418,633 F267S probably damaging Het
Lrrn2 T G 1: 132,937,751 F185V probably damaging Het
Mecom A G 3: 29,952,814 S764P probably benign Het
Mfsd14b C G 13: 65,067,982 G386R probably damaging Het
Mrm2 A G 5: 140,328,400 S227P probably damaging Het
Mug1 A G 6: 121,856,291 N285S probably benign Het
Nalcn T C 14: 123,281,145 T1661A probably benign Het
Ncoa6 G A 2: 155,406,159 R1742* probably null Het
Nln T A 13: 104,037,369 H548L probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr457 A T 6: 42,472,051 N42K probably damaging Het
Olfr688 T A 7: 105,288,186 I31N probably benign Het
Pgm5 T C 19: 24,733,563 Y425C probably damaging Het
Pld2 A G 11: 70,542,960 D242G probably damaging Het
Plekhm1 A G 11: 103,397,025 probably null Het
Ptdss1 T C 13: 66,976,817 probably benign Het
Pyroxd2 G T 19: 42,733,770 L415I probably benign Het
Rapgef6 A G 11: 54,631,249 T291A probably damaging Het
Rb1 A G 14: 73,280,252 I238T probably benign Het
Rp1 G A 1: 4,348,352 H846Y probably damaging Het
Rpgrip1 T A 14: 52,136,622 probably null Het
Scaf4 T C 16: 90,252,425 D258G unknown Het
Ska1 A T 18: 74,206,849 C9S probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc43a1 G A 2: 84,849,831 R107Q probably damaging Het
Slc44a3 T A 3: 121,525,670 N141Y probably damaging Het
Slit1 A T 19: 41,637,483 D613E probably benign Het
Spata22 A T 11: 73,340,253 Y111F probably benign Het
Tchh C A 3: 93,443,918 R222S unknown Het
Tekt3 A G 11: 63,094,697 D443G possibly damaging Het
Tns2 A T 15: 102,107,119 Q144L possibly damaging Het
Troap T C 15: 99,078,817 V274A possibly damaging Het
Ugt1a8 A G 1: 88,088,273 Y136C probably damaging Het
Vmn2r23 A T 6: 123,741,499 M604L probably benign Het
Vps13b T A 15: 35,597,493 W1060R probably damaging Het
Wdfy3 A G 5: 101,895,060 S1942P probably damaging Het
Wdr90 G A 17: 25,846,603 T1596I probably damaging Het
Zc3h4 A G 7: 16,416,940 E69G possibly damaging Het
Other mutations in Epha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Epha1 APN 6 42360551 missense probably damaging 1.00
IGL02388:Epha1 APN 6 42365016 missense probably damaging 1.00
IGL02614:Epha1 APN 6 42360557 missense probably benign 0.02
IGL03019:Epha1 APN 6 42362752 missense probably damaging 1.00
buddy UTSW 6 42361451 missense probably damaging 1.00
R0369:Epha1 UTSW 6 42365473 missense probably damaging 1.00
R0894:Epha1 UTSW 6 42363822 missense probably benign 0.45
R1353:Epha1 UTSW 6 42361837 missense probably damaging 0.99
R1451:Epha1 UTSW 6 42361451 missense probably damaging 1.00
R1840:Epha1 UTSW 6 42363588 missense probably damaging 0.99
R2064:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2065:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2067:Epha1 UTSW 6 42366053 missense probably benign 0.01
R3691:Epha1 UTSW 6 42361130 missense probably damaging 1.00
R3952:Epha1 UTSW 6 42364285 missense probably damaging 0.99
R4111:Epha1 UTSW 6 42358838 missense possibly damaging 0.88
R4280:Epha1 UTSW 6 42365052 missense probably damaging 1.00
R4369:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4371:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4491:Epha1 UTSW 6 42360666 missense probably damaging 1.00
R4743:Epha1 UTSW 6 42372221 missense probably benign 0.00
R4838:Epha1 UTSW 6 42363816 missense probably benign 0.04
R4847:Epha1 UTSW 6 42361914 missense possibly damaging 0.88
R4857:Epha1 UTSW 6 42361482 missense probably benign 0.00
R4884:Epha1 UTSW 6 42360734 missense probably damaging 0.99
R4929:Epha1 UTSW 6 42364599 missense probably benign 0.05
R5239:Epha1 UTSW 6 42365010 missense possibly damaging 0.87
R5416:Epha1 UTSW 6 42365871 missense probably damaging 1.00
R5595:Epha1 UTSW 6 42364634 missense possibly damaging 0.78
R5838:Epha1 UTSW 6 42361646 missense probably damaging 1.00
R6395:Epha1 UTSW 6 42366172 missense probably damaging 1.00
R6594:Epha1 UTSW 6 42364691 missense probably benign
R6639:Epha1 UTSW 6 42365935 nonsense probably null
R7092:Epha1 UTSW 6 42364245 missense probably benign 0.36
R7569:Epha1 UTSW 6 42365422 missense possibly damaging 0.70
R7705:Epha1 UTSW 6 42362668 missense probably damaging 0.99
R7802:Epha1 UTSW 6 42361941 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGACAGCTATCAGGGCAGAG -3'
(R):5'- ATGTCTTCCGTTCAAGGTGCTG -3'

Sequencing Primer
(F):5'- GCTATCAGGGCAGAGTTAATTAACC -3'
(R):5'- GTTAGGCTGTACCCCCTAATG -3'
Posted On2014-09-18