Mutagenetix > Incidental Mutations

Incidental Mutation 'R2087:Ganc'

231501

Institutional Source

Beutler Lab

Gene Symbol

Ganc

Ensembl Gene

ENSMUSG00000062646

Gene Name

glucosidase, alpha; neutral C

Synonyms

5830445O15Rik

MMRRC Submission

040092-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.646) question?

Stock #

R2087 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120403896-120461700 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120457257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 822 (Y822C)

Ref Sequence

ENSEMBL: ENSMUSP00000116898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000135074]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000043755

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124129

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127367

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131523

Predicted Effect

probably damaging
Transcript: ENSMUST00000135074
AA Change: Y822C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646
AA Change: Y822C

Domain	Start	End	E-Value	Type
low complexity region	30	44	N/A	INTRINSIC
Pfam:Gal_mutarotas_2	221	292	2.3e-21	PFAM
Pfam:Glyco_hydro_31	333	778	2.5e-137	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136993

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145993

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152437

Meta Mutation Damage Score

0.7488

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021P04Rik	T	A	19: 24,065,000		noncoding transcript	Het
Adamts8	G	A	9: 30,962,112	R871Q	probably damaging	Het
Ank1	T	C	8: 23,093,811	L310S	probably damaging	Het
Atp2a3	A	G	11: 72,980,448	T592A	probably damaging	Het
Bpifb6	A	G	2: 153,906,078	D219G	possibly damaging	Het
Catsper4	T	C	4: 134,226,605	N81S	probably damaging	Het
Ccdc14	T	C	16: 34,695,645		probably null	Het
Ces1c	A	C	8: 93,107,602	N353K	probably benign	Het
Chrna6	T	A	8: 27,407,127	M241L	probably benign	Het
Chtf8	T	A	8: 106,885,936	R124*	probably null	Het
Cpt1b	A	G	15: 89,422,208	V296A	probably benign	Het
Cryl1	G	A	14: 57,275,945	S273L	possibly damaging	Het
Ctps	T	C	4: 120,562,815	D134G	probably benign	Het
Cyp4f18	T	C	8: 72,000,988	M138V	probably benign	Het
Dnajb12	A	G	10: 59,890,845	K107R	possibly damaging	Het
Epha1	C	T	6: 42,363,568	D590N	probably benign	Het
Fndc3b	A	G	3: 27,451,554	V855A	probably benign	Het
Hook2	A	G	8: 85,002,691	D622G	probably damaging	Het
Kcnj8	T	A	6: 142,565,696	N395I	probably benign	Het
Kdm4b	T	C	17: 56,389,564	S427P	possibly damaging	Het
Krt12	A	G	11: 99,418,633	F267S	probably damaging	Het
Lrrn2	T	G	1: 132,937,751	F185V	probably damaging	Het
Mecom	A	G	3: 29,952,814	S764P	probably benign	Het
Mfsd14b	C	G	13: 65,067,982	G386R	probably damaging	Het
Mrm2	A	G	5: 140,328,400	S227P	probably damaging	Het
Mug1	A	G	6: 121,856,291	N285S	probably benign	Het
Nalcn	T	C	14: 123,281,145	T1661A	probably benign	Het
Ncoa6	G	A	2: 155,406,159	R1742*	probably null	Het
Nln	T	A	13: 104,037,369	H548L	probably damaging	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Olfr457	A	T	6: 42,472,051	N42K	probably damaging	Het
Olfr688	T	A	7: 105,288,186	I31N	probably benign	Het
Pgm5	T	C	19: 24,733,563	Y425C	probably damaging	Het
Pld2	A	G	11: 70,542,960	D242G	probably damaging	Het
Plekhm1	A	G	11: 103,397,025		probably null	Het
Ptdss1	T	C	13: 66,976,817		probably benign	Het
Pyroxd2	G	T	19: 42,733,770	L415I	probably benign	Het
Rapgef6	A	G	11: 54,631,249	T291A	probably damaging	Het
Rb1	A	G	14: 73,280,252	I238T	probably benign	Het
Rp1	G	A	1: 4,348,352	H846Y	probably damaging	Het
Rpgrip1	T	A	14: 52,136,622		probably null	Het
Scaf4	T	C	16: 90,252,425	D258G	unknown	Het
Ska1	A	T	18: 74,206,849	C9S	probably benign	Het
Skp2	C	A	15: 9,113,698	G376C	probably damaging	Het
Slc43a1	G	A	2: 84,849,831	R107Q	probably damaging	Het
Slc44a3	T	A	3: 121,525,670	N141Y	probably damaging	Het
Slit1	A	T	19: 41,637,483	D613E	probably benign	Het
Spata22	A	T	11: 73,340,253	Y111F	probably benign	Het
Tchh	C	A	3: 93,443,918	R222S	unknown	Het
Tekt3	A	G	11: 63,094,697	D443G	possibly damaging	Het
Tns2	A	T	15: 102,107,119	Q144L	possibly damaging	Het
Troap	T	C	15: 99,078,817	V274A	possibly damaging	Het
Ugt1a8	A	G	1: 88,088,273	Y136C	probably damaging	Het
Vmn2r23	A	T	6: 123,741,499	M604L	probably benign	Het
Vps13b	T	A	15: 35,597,493	W1060R	probably damaging	Het
Wdfy3	A	G	5: 101,895,060	S1942P	probably damaging	Het
Wdr90	G	A	17: 25,846,603	T1596I	probably damaging	Het
Zc3h4	A	G	7: 16,416,940	E69G	possibly damaging	Het

Other mutations in Ganc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Ganc	APN	2	120441598	missense	probably damaging	1.00
IGL00913:Ganc	APN	2	120439452	splice site	probably benign
IGL01077:Ganc	APN	2	120446515	missense	possibly damaging	0.50
IGL01773:Ganc	APN	2	120459884	missense	possibly damaging	0.87
IGL01812:Ganc	APN	2	120411526	missense	probably benign	0.00
IGL02029:Ganc	APN	2	120459857	missense	probably benign	0.00
IGL02067:Ganc	APN	2	120406304	missense	probably benign	0.16
IGL02290:Ganc	APN	2	120448423	missense	possibly damaging	0.90
IGL02355:Ganc	APN	2	120433757	missense	probably damaging	1.00
IGL02362:Ganc	APN	2	120433757	missense	probably damaging	1.00
IGL02553:Ganc	APN	2	120458134	missense	probably benign
IGL02808:Ganc	APN	2	120411511	missense	probably benign	0.00
IGL02966:Ganc	APN	2	120433648	missense	probably damaging	1.00
IGL03356:Ganc	APN	2	120435288	missense	probably benign	0.22
IGL03405:Ganc	APN	2	120433766	missense	probably damaging	1.00
ingenuous	UTSW	2	120444149	missense	probably damaging	1.00
R0464:Ganc	UTSW	2	120436694	missense	probably benign	0.07
R0511:Ganc	UTSW	2	120448401	nonsense	probably null
R0932:Ganc	UTSW	2	120458129	missense	probably damaging	0.99
R1467:Ganc	UTSW	2	120430928	splice site	probably benign
R1902:Ganc	UTSW	2	120446482	missense	probably damaging	1.00
R4668:Ganc	UTSW	2	120431067	missense	probably benign	0.02
R4669:Ganc	UTSW	2	120431067	missense	probably benign	0.02
R4725:Ganc	UTSW	2	120435273	missense	probably damaging	0.99
R4735:Ganc	UTSW	2	120436623	splice site	silent
R4738:Ganc	UTSW	2	120452594	missense	probably damaging	0.97
R4839:Ganc	UTSW	2	120459823	missense	probably benign
R4951:Ganc	UTSW	2	120456047	missense	probably benign	0.00
R5841:Ganc	UTSW	2	120411539	missense	possibly damaging	0.65
R5997:Ganc	UTSW	2	120430605	missense	possibly damaging	0.55
R6142:Ganc	UTSW	2	120430737	critical splice donor site	probably null
R6378:Ganc	UTSW	2	120433826	missense	probably damaging	1.00
R6711:Ganc	UTSW	2	120450839	missense	possibly damaging	0.74
R6777:Ganc	UTSW	2	120444149	missense	probably damaging	1.00
R7229:Ganc	UTSW	2	120427775	missense	possibly damaging	0.92
R7235:Ganc	UTSW	2	120433717	missense	probably damaging	1.00
R7241:Ganc	UTSW	2	120441529	missense	probably damaging	1.00
R7326:Ganc	UTSW	2	120430599	missense	probably damaging	1.00
R7567:Ganc	UTSW	2	120456101	missense	probably benign	0.01
R7685:Ganc	UTSW	2	120433792	missense	probably damaging	1.00
R7736:Ganc	UTSW	2	120433814	missense	possibly damaging	0.83
R7784:Ganc	UTSW	2	120436668	nonsense	probably null
R7955:Ganc	UTSW	2	120430700	missense	probably damaging	1.00
R8222:Ganc	UTSW	2	120446452	missense	probably damaging	1.00
R8247:Ganc	UTSW	2	120436700	missense	probably null	0.52
R8306:Ganc	UTSW	2	120422079	missense	probably benign	0.02
R9282:Ganc	UTSW	2	120459900	missense	probably benign
X0027:Ganc	UTSW	2	120448450	missense	probably damaging	1.00
Z1177:Ganc	UTSW	2	120433794	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCAGTTCAAATGCTCAGC -3'
(R):5'- TGATTCATTGGTACATGGAGGAATG -3'

Sequencing Primer
(F):5'- GCAGTTCAAATGCTCAGCTCTTCAG -3'
(R):5'- GCAACCAGGGTTCTTTAAGC -3'

Posted On

2014-09-18