Incidental Mutation 'R2152:Ppp4r3a'
ID234423
Institutional Source Beutler Lab
Gene Symbol Ppp4r3a
Ensembl Gene ENSMUSG00000041846
Gene Nameprotein phosphatase 4 regulatory subunit 3A
Synonyms1110034C04Rik, Smek1
MMRRC Submission 040155-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R2152 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101039409-101083702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101042567 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 684 (N684K)
Ref Sequence ENSEMBL: ENSMUSP00000129654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048305] [ENSMUST00000163095] [ENSMUST00000223091]
Predicted Effect probably damaging
Transcript: ENSMUST00000048305
AA Change: N671K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041667
Gene: ENSMUSG00000041846
AA Change: N671K

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 3e-24 SMART
Pfam:SMK-1 164 357 5.8e-85 PFAM
low complexity region 407 418 N/A INTRINSIC
low complexity region 495 503 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163095
AA Change: N684K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129654
Gene: ENSMUSG00000041846
AA Change: N684K

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 4e-24 SMART
Pfam:SMK-1 166 357 2.5e-84 PFAM
low complexity region 508 516 N/A INTRINSIC
low complexity region 718 733 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 808 821 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222956
Predicted Effect probably benign
Transcript: ENSMUST00000223091
Predicted Effect unknown
Transcript: ENSMUST00000223459
AA Change: N60K
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,934 D298V probably damaging Het
Ackr3 A T 1: 90,213,843 Y8F probably benign Het
Acy1 T C 9: 106,435,617 E175G probably damaging Het
Add2 T C 6: 86,098,598 L243P probably damaging Het
Adsl A G 15: 80,967,662 D407G probably damaging Het
Afg3l1 T G 8: 123,494,836 I478S probably damaging Het
Arfrp1 T C 2: 181,359,694 T108A probably benign Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bbs12 G T 3: 37,321,160 E586* probably null Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Bid A T 6: 120,900,254 L42Q probably damaging Het
Bpifb9a A G 2: 154,260,135 K51E probably benign Het
Calcr G T 6: 3,687,615 T424K probably benign Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntn3 A G 6: 102,206,537 I719T probably damaging Het
Cyb5r1 T C 1: 134,409,625 I163T possibly damaging Het
Cyp2d26 A T 15: 82,792,706 probably null Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dgcr2 G A 16: 17,891,487 probably null Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dnah3 C T 7: 119,952,013 V3028I probably benign Het
Dnah6 T C 6: 73,049,166 Y3448C probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Doxl2 T A 6: 48,976,539 I466N probably damaging Het
Epb41l1 A G 2: 156,514,128 D528G probably damaging Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Fgfr4 A T 13: 55,166,964 Y640F probably damaging Het
Foxo6 T A 4: 120,268,614 D328V probably benign Het
Foxp1 A G 6: 99,016,541 L134P probably damaging Het
Frem2 G A 3: 53,517,029 R2996* probably null Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gcn1l1 T A 5: 115,609,829 I1765N probably benign Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gpc6 G T 14: 116,926,092 A53S probably benign Het
Gtpbp8 A G 16: 44,740,027 probably null Het
H2-Q2 T C 17: 35,345,276 probably null Het
Hapln2 C A 3: 88,023,613 R157L probably benign Het
Hemgn C A 4: 46,396,607 E210* probably null Het
Hpse T A 5: 100,691,403 K360* probably null Het
Iqcj A T 3: 68,055,310 E68V probably damaging Het
Kat2a T C 11: 100,712,346 probably benign Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Klhl30 C A 1: 91,357,824 A356D probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Micu1 G T 10: 59,863,288 M468I probably benign Het
Mrc1 A G 2: 14,327,864 T1292A probably damaging Het
Myh8 G A 11: 67,294,469 E849K probably damaging Het
Myom3 G T 4: 135,803,233 R1152L probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nlrp4g T A 9: 124,353,339 noncoding transcript Het
Olfr1339 C T 4: 118,735,249 A240V possibly damaging Het
Olfr1413 T C 1: 92,573,908 S246P probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr33 G T 7: 102,713,581 H277Q probably benign Het
Olfr435 A G 6: 43,202,069 I142V probably benign Het
Olfr592 A T 7: 103,186,640 D13V probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Olfr969 A T 9: 39,795,647 I91F probably benign Het
Otop1 T A 5: 38,302,851 M587K probably damaging Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phc2 A G 4: 128,745,066 *41W probably null Het
Piezo2 A T 18: 63,114,041 M532K probably damaging Het
Pjvk A T 2: 76,658,369 I295F probably benign Het
Popdc2 A G 16: 38,363,120 N155S possibly damaging Het
Prpf4b T A 13: 34,900,419 M930K probably benign Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Ptprz1 C A 6: 23,030,671 L1010I probably damaging Het
Rabepk A T 2: 34,784,550 D232E possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rb1 T C 14: 73,288,725 T169A probably benign Het
Rcc2 T C 4: 140,717,117 L373P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Sdk1 A G 5: 141,792,944 N226D probably damaging Het
Selenbp1 G A 3: 94,944,130 R398H probably damaging Het
Selenoo A G 15: 89,099,282 M509V probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc2a5 T G 4: 150,125,638 S27A probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slc5a9 A G 4: 111,893,223 I146T possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Snx29 A G 16: 11,400,843 D181G possibly damaging Het
Spata31d1c G A 13: 65,033,965 probably null Het
Stat5a C A 11: 100,874,090 T213N probably benign Het
Stt3a A T 9: 36,747,996 V349D probably damaging Het
Tcf20 A T 15: 82,855,602 D549E probably damaging Het
Thbs2 T A 17: 14,673,209 D903V probably damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmc1 A T 19: 20,856,675 N241K probably benign Het
Tmem260 G T 14: 48,477,609 R240L possibly damaging Het
Tnfaip6 A T 2: 52,043,730 E32D probably damaging Het
Trpa1 A T 1: 14,899,401 H381Q probably damaging Het
Tsen2 T C 6: 115,547,975 I45T possibly damaging Het
Ttc6 G A 12: 57,705,552 V1415I probably damaging Het
Ttll7 G T 3: 146,930,189 R426L probably damaging Het
Ttn A C 2: 76,740,138 S26804A probably damaging Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn2r73 A G 7: 85,857,728 V792A probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Ppp4r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ppp4r3a APN 12 101049794 missense probably damaging 1.00
IGL00532:Ppp4r3a APN 12 101044653 missense probably damaging 1.00
IGL01359:Ppp4r3a APN 12 101058496 missense probably damaging 0.99
IGL01873:Ppp4r3a APN 12 101041835 missense possibly damaging 0.86
IGL02676:Ppp4r3a APN 12 101042511 missense probably benign 0.00
IGL02756:Ppp4r3a APN 12 101058323 critical splice donor site probably null
IGL03196:Ppp4r3a APN 12 101049654 splice site probably benign
IGL03206:Ppp4r3a APN 12 101058619 missense probably damaging 1.00
R1101:Ppp4r3a UTSW 12 101051571 missense probably damaging 0.98
R1434:Ppp4r3a UTSW 12 101043524 missense probably damaging 0.99
R1526:Ppp4r3a UTSW 12 101040741 missense probably damaging 0.99
R1554:Ppp4r3a UTSW 12 101055822 missense probably damaging 1.00
R1650:Ppp4r3a UTSW 12 101044619 missense probably damaging 0.99
R1766:Ppp4r3a UTSW 12 101058482 missense probably damaging 0.99
R2322:Ppp4r3a UTSW 12 101042619 missense probably damaging 0.98
R2421:Ppp4r3a UTSW 12 101042653 splice site probably benign
R2422:Ppp4r3a UTSW 12 101042653 splice site probably benign
R2859:Ppp4r3a UTSW 12 101042647 critical splice acceptor site probably null
R2884:Ppp4r3a UTSW 12 101068677 missense probably damaging 0.99
R4157:Ppp4r3a UTSW 12 101055619 missense probably damaging 0.97
R4651:Ppp4r3a UTSW 12 101082911 utr 5 prime probably benign
R4652:Ppp4r3a UTSW 12 101082911 utr 5 prime probably benign
R4706:Ppp4r3a UTSW 12 101041916 missense probably damaging 1.00
R4773:Ppp4r3a UTSW 12 101082767 missense possibly damaging 0.93
R4775:Ppp4r3a UTSW 12 101053566 missense probably damaging 0.99
R5467:Ppp4r3a UTSW 12 101043470 missense probably damaging 0.99
R5634:Ppp4r3a UTSW 12 101043521 missense probably damaging 1.00
R5704:Ppp4r3a UTSW 12 101083360 utr 5 prime probably benign
R5707:Ppp4r3a UTSW 12 101058511 missense probably damaging 1.00
R5935:Ppp4r3a UTSW 12 101051613 missense probably damaging 1.00
R5969:Ppp4r3a UTSW 12 101043579 missense probably benign
R6030:Ppp4r3a UTSW 12 101058400 missense probably damaging 0.97
R6030:Ppp4r3a UTSW 12 101058400 missense probably damaging 0.97
R6630:Ppp4r3a UTSW 12 101049776 missense probably damaging 1.00
R7265:Ppp4r3a UTSW 12 101053511 missense possibly damaging 0.77
R7352:Ppp4r3a UTSW 12 101041832 missense probably damaging 1.00
R7402:Ppp4r3a UTSW 12 101058794 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TAACCTCCGAACCGTCTTCC -3'
(R):5'- TGTAGTATGGCTTAAAAGTCTGTACA -3'

Sequencing Primer
(F):5'- GGAGTAGCGACTAATCATTTCCTC -3'
(R):5'- TGGCTTAAAAGTCTGTACATTGATC -3'
Posted On2014-10-01