Incidental Mutation 'R2154:Acox3'
ID234604
Institutional Source Beutler Lab
Gene Symbol Acox3
Ensembl Gene ENSMUSG00000029098
Gene Nameacyl-Coenzyme A oxidase 3, pristanoyl
SynonymsEST-s59, pristanoyl-CoA oxidase, PCOX
MMRRC Submission 040157-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2154 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location35583040-35615352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35605224 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 481 (S481C)
Ref Sequence ENSEMBL: ENSMUSP00000144499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068563] [ENSMUST00000068947] [ENSMUST00000114237] [ENSMUST00000114238] [ENSMUST00000202266]
Predicted Effect probably damaging
Transcript: ENSMUST00000068563
AA Change: S481C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067178
Gene: ENSMUSG00000029098
AA Change: S481C

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 213 3e-15 PFAM
Pfam:Acyl-CoA_dh_1 297 466 6e-9 PFAM
Pfam:ACOX 507 662 5.2e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068947
AA Change: S481C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063412
Gene: ENSMUSG00000029098
AA Change: S481C

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 266 8.7e-18 PFAM
Pfam:Acyl-CoA_dh_1 297 466 5.5e-8 PFAM
Pfam:ACOX 510 690 6.4e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114237
AA Change: S481C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109875
Gene: ENSMUSG00000029098
AA Change: S481C

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 213 5.7e-15 PFAM
Pfam:Acyl-CoA_dh_1 297 466 9.4e-9 PFAM
Pfam:ACOX 507 695 1.6e-50 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114238
AA Change: S481C
SMART Domains Protein: ENSMUSP00000109876
Gene: ENSMUSG00000029098
AA Change: S481C

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 198 309 1.4e-17 PFAM
Pfam:Acyl-CoA_dh_1 340 509 1.3e-7 PFAM
Pfam:ACOX 553 707 1.4e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154796
Predicted Effect unknown
Transcript: ENSMUST00000201106
AA Change: S47C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201659
Predicted Effect probably damaging
Transcript: ENSMUST00000202266
AA Change: S481C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144499
Gene: ENSMUSG00000029098
AA Change: S481C

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 266 4.5e-18 PFAM
Pfam:Acyl-CoA_dh_1 297 466 3.2e-8 PFAM
Pfam:ACOX 510 667 1.6e-45 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. Unlike the rat homolog, the human gene is expressed in very low amounts in liver such that its mRNA was undetectable by routine Northern-blot analysis or its product by immunoblotting or by enzyme activity measurements. However the human cDNA encoding a 700 amino acid protein with a peroxisomal targeting C-terminal tripeptide S-K-L was isolated and is thought to be expressed under special conditions such as specific developmental stages or in a tissue specific manner in tissues that have not yet been examined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
Abca3 A G 17: 24,377,719 Y382C probably damaging Het
Abca5 A G 11: 110,292,174 I1019T probably benign Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Aqr A C 2: 114,137,004 M510R probably damaging Het
Arpc1a A T 5: 145,092,559 T56S probably benign Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Aspg A G 12: 112,120,974 E288G probably benign Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Cabcoco1 A G 10: 68,431,262 L205P probably damaging Het
Cant1 A G 11: 118,411,437 L18P probably damaging Het
Cdca2 G A 14: 67,676,976 P945S probably damaging Het
Cfap74 A G 4: 155,429,296 K522E possibly damaging Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cpa6 A T 1: 10,337,322 M330K probably damaging Het
Creb3l4 G T 3: 90,238,485 N246K probably damaging Het
Cyp2c55 T A 19: 39,034,375 V319D probably damaging Het
Dapk1 T A 13: 60,729,503 S519T probably benign Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dock4 T A 12: 40,820,662 V1467E probably damaging Het
Dock4 ACCTGCTCTGCC ACCTGCTCTGCCTGCTCTGCC 12: 40,844,548 probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Ercc6l2 T C 13: 63,866,007 S631P probably damaging Het
Fat4 A T 3: 38,887,539 S194C probably damaging Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gdf10 T C 14: 33,934,389 I436T probably damaging Het
Gfod1 T C 13: 43,303,470 T10A possibly damaging Het
Gucy1a1 A G 3: 82,111,151 probably null Het
Heatr5b G T 17: 78,831,444 Q90K probably benign Het
Ikzf3 T A 11: 98,485,649 K211* probably null Het
Itgam A C 7: 128,085,577 D373A probably damaging Het
Itpripl2 A G 7: 118,489,884 F484S probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kif16b T C 2: 142,690,580 K1213R probably damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Mtf2 A G 5: 108,080,931 K38E possibly damaging Het
Myh14 A C 7: 44,652,429 probably null Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nfkb1 T C 3: 135,601,479 T562A probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Pds5a A T 5: 65,650,498 V464E probably damaging Het
Peak1 C T 9: 56,207,212 V452M probably damaging Het
Phf2 T C 13: 48,820,073 Y372C unknown Het
Poc1a T A 9: 106,285,574 probably null Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psmc2 C G 5: 21,803,129 L344V possibly damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Rabgap1 T C 2: 37,475,441 V242A probably damaging Het
Rad1 C A 15: 10,486,635 H39Q possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Samd9l C T 6: 3,372,945 D1439N possibly damaging Het
Sbno1 A T 5: 124,378,511 D1266E probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc22a13 T C 9: 119,208,687 K125R probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Smg1 A T 7: 118,158,076 probably benign Het
Spinkl A T 18: 44,169,127 N32K probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmco6 T C 18: 36,741,687 V409A probably benign Het
Tstd2 T C 4: 46,129,235 T198A probably damaging Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r45 T A 6: 89,933,983 S2C possibly damaging Het
Vmn2r25 T A 6: 123,839,846 T259S probably benign Het
Vmn2r70 A G 7: 85,563,715 S495P possibly damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yme1l1 T C 2: 23,162,508 L58P probably damaging Het
Zan G A 5: 137,414,249 probably benign Het
Zfhx4 A G 3: 5,401,741 T2320A possibly damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Acox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Acox3 APN 5 35588752 missense probably benign 0.02
IGL02118:Acox3 APN 5 35601521 missense possibly damaging 0.55
IGL02554:Acox3 APN 5 35608366 missense probably damaging 1.00
IGL03377:Acox3 APN 5 35594332 missense probably damaging 1.00
R1543:Acox3 UTSW 5 35603008 missense probably damaging 1.00
R1661:Acox3 UTSW 5 35603027 missense probably damaging 1.00
R1665:Acox3 UTSW 5 35603027 missense probably damaging 1.00
R1707:Acox3 UTSW 5 35601564 missense possibly damaging 0.87
R1725:Acox3 UTSW 5 35592172 missense probably benign 0.26
R1763:Acox3 UTSW 5 35608339 splice site probably null
R1851:Acox3 UTSW 5 35609062 missense possibly damaging 0.72
R1923:Acox3 UTSW 5 35592115 missense possibly damaging 0.80
R2418:Acox3 UTSW 5 35604638 missense probably benign 0.21
R2892:Acox3 UTSW 5 35594317 missense probably damaging 1.00
R2893:Acox3 UTSW 5 35599848 missense probably benign 0.02
R2894:Acox3 UTSW 5 35599848 missense probably benign 0.02
R2964:Acox3 UTSW 5 35605267 missense possibly damaging 0.81
R3431:Acox3 UTSW 5 35589216 missense possibly damaging 0.47
R3735:Acox3 UTSW 5 35611153 missense probably benign 0.02
R3736:Acox3 UTSW 5 35611153 missense probably benign 0.02
R4106:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4107:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4108:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4579:Acox3 UTSW 5 35604643 missense probably damaging 1.00
R4862:Acox3 UTSW 5 35589739 missense probably benign 0.22
R4903:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R4949:Acox3 UTSW 5 35612106 missense probably benign 0.06
R4964:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R4966:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R5170:Acox3 UTSW 5 35588625 missense probably benign 0.42
R5278:Acox3 UTSW 5 35588156 splice site probably benign
R5569:Acox3 UTSW 5 35603033 missense probably damaging 1.00
R5733:Acox3 UTSW 5 35605199 splice site probably null
R5741:Acox3 UTSW 5 35608324 missense probably benign 0.07
R6530:Acox3 UTSW 5 35588695 missense possibly damaging 0.65
R6580:Acox3 UTSW 5 35608403 missense probably damaging 1.00
R6736:Acox3 UTSW 5 35588854 critical splice donor site probably null
R6848:Acox3 UTSW 5 35592184 missense probably damaging 1.00
R7012:Acox3 UTSW 5 35612087 missense probably benign 0.14
R7233:Acox3 UTSW 5 35605297 missense probably benign 0.01
R7477:Acox3 UTSW 5 35592103 nonsense probably null
R7837:Acox3 UTSW 5 35611486 critical splice acceptor site probably null
R7844:Acox3 UTSW 5 35607148 missense probably benign 0.05
Z1088:Acox3 UTSW 5 35588222 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAACAAAGGCCATCACTTG -3'
(R):5'- ATGTATGGCAACCAAACCAAGG -3'

Sequencing Primer
(F):5'- CATCACTTGGTGGCAGAGG -3'
(R):5'- GTATGGCAACCAAACCAAGGAGATAC -3'
Posted On2014-10-01