Incidental Mutation 'R2257:Mrps35'
ID243450
Institutional Source Beutler Lab
Gene Symbol Mrps35
Ensembl Gene ENSMUSG00000040112
Gene Namemitochondrial ribosomal protein S35
SynonymsMRPS28, MRP-S28, MDSO23
MMRRC Submission 040257-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R2257 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location147042764-147073991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147070627 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 256 (E256G)
Ref Sequence ENSEMBL: ENSMUSP00000048348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036111] [ENSMUST00000100780]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036111
AA Change: E256G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048348
Gene: ENSMUSG00000040112
AA Change: E256G

DomainStartEndE-ValueType
Pfam:MRP-S28 138 262 2.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100780
SMART Domains Protein: ENSMUSP00000098343
Gene: ENSMUSG00000072662

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MANEC 24 113 5.4e-34 SMART
low complexity region 263 274 N/A INTRINSIC
transmembrane domain 284 306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143204
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that has had confusing nomenclature in the literature. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 3p, 5q, and 10q. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4930567H17Rik A T X: 70,394,406 W94R probably damaging Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
Abcc3 C T 11: 94,363,594 V693M probably damaging Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Ap1s1 T C 5: 137,041,779 Y94C possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Cabs1 T C 5: 87,980,215 S242P probably damaging Het
Cass4 T C 2: 172,427,470 F493L probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Cfap100 C G 6: 90,413,820 R184P possibly damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Dhx36 C T 3: 62,477,643 G683S probably damaging Het
Dnah10 T A 5: 124,761,237 I1110N probably damaging Het
Dnajc3 C G 14: 118,972,702 P322A probably benign Het
Eml4 A G 17: 83,477,760 T785A probably damaging Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fcrls T C 3: 87,259,621 I22V probably damaging Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Grm8 A T 6: 27,760,225 C369S probably damaging Het
Hdc G A 2: 126,616,080 probably null Het
Hsf3 A T X: 96,320,322 L191* probably null Het
Kif4 A T X: 100,726,131 N1126Y probably benign Het
Lat2 T C 5: 134,602,627 D191G probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Lmo7 T C 14: 101,900,130 L634P probably damaging Het
Lrrc6 T A 15: 66,437,587 probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mgat4a T C 1: 37,490,313 N24D probably benign Het
Mical3 A T 6: 121,033,735 S429T possibly damaging Het
Mybbp1a T A 11: 72,446,195 S586T probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nob1 A G 8: 107,417,097 probably benign Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Olfr845 A G 9: 19,338,493 E11G probably benign Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Pias3 C T 3: 96,699,646 T75I probably benign Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Prrc2a G A 17: 35,161,068 P185L unknown Het
Prss57 C T 10: 79,787,370 C81Y probably damaging Het
Psen1 C T 12: 83,714,820 S132L probably damaging Het
Ranbp6 A G 19: 29,811,549 S468P possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmprss7 A T 16: 45,686,333 M122K possibly damaging Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Uap1 A T 1: 170,158,743 probably benign Het
Ugdh A T 5: 65,417,115 probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps13a G A 19: 16,682,174 T1663I possibly damaging Het
Vps13c A C 9: 67,952,946 I2815L possibly damaging Het
Zc3h3 G T 15: 75,839,566 Q349K possibly damaging Het
Other mutations in Mrps35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Mrps35 APN 6 147055921 missense possibly damaging 0.86
IGL01776:Mrps35 APN 6 147070716 missense probably benign 0.33
IGL02134:Mrps35 APN 6 147048310 splice site probably benign
IGL03382:Mrps35 APN 6 147049875 nonsense probably null
R0600:Mrps35 UTSW 6 147070734 missense possibly damaging 0.53
R0648:Mrps35 UTSW 6 147055945 nonsense probably null
R1466:Mrps35 UTSW 6 147055984 missense probably damaging 0.98
R1466:Mrps35 UTSW 6 147055984 missense probably damaging 0.98
R1584:Mrps35 UTSW 6 147055984 missense probably damaging 0.98
R1655:Mrps35 UTSW 6 147060228 missense possibly damaging 0.84
R2018:Mrps35 UTSW 6 147061484 nonsense probably null
R4989:Mrps35 UTSW 6 147060147 missense possibly damaging 0.85
R5174:Mrps35 UTSW 6 147060211 missense possibly damaging 0.93
R5453:Mrps35 UTSW 6 147070617 missense probably benign 0.32
R6682:Mrps35 UTSW 6 147048279 missense possibly damaging 0.86
R7181:Mrps35 UTSW 6 147055993 critical splice donor site probably null
R7409:Mrps35 UTSW 6 147055983 missense possibly damaging 0.71
R8132:Mrps35 UTSW 6 147048163 missense probably benign
X0066:Mrps35 UTSW 6 147070720 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GAGGCAGAACAACCCTTGAG -3'
(R):5'- GACTCCTTGTACTGAGCGAG -3'

Sequencing Primer
(F):5'- CCATGCAGGCTTTAAGGGTAC -3'
(R):5'- TACTGAGCGAGGCTTGCCTC -3'
Posted On2014-10-16