Incidental Mutation 'R2341:Nedd9'
ID246762
Institutional Source Beutler Lab
Gene Symbol Nedd9
Ensembl Gene ENSMUSG00000021365
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 9
SynonymsE230025G09Rik, HEF1, Cas-L, CasL
MMRRC Submission 040327-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2341 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location41309581-41487362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41316511 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 389 (S389P)
Ref Sequence ENSEMBL: ENSMUSP00000125773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021794] [ENSMUST00000163623] [ENSMUST00000224803]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021794
AA Change: S389P

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021794
Gene: ENSMUSG00000021365
AA Change: S389P

DomainStartEndE-ValueType
SH3 6 64 3.78e-17 SMART
internal_repeat_1 151 218 1.33e-7 PROSPERO
low complexity region 368 396 N/A INTRINSIC
Pfam:Serine_rich 403 561 3.2e-66 PFAM
Pfam:DUF3513 611 828 1.4e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163623
AA Change: S389P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125773
Gene: ENSMUSG00000021365
AA Change: S389P

DomainStartEndE-ValueType
SH3 6 64 3.78e-17 SMART
internal_repeat_1 151 218 1.42e-7 PROSPERO
low complexity region 368 396 N/A INTRINSIC
Pfam:Serine_rich 403 559 2.7e-60 PFAM
Pfam:DUF3513 618 827 1e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224803
Meta Mutation Damage Score 0.0674 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the CRK-associated substrates family. Members of this family are adhesion docking molecules that mediate protein-protein interactions for signal transduction pathways. This protein is a focal adhesion protein that acts as a scaffold to regulate signaling complexes important in cell attachment, migration and invasion as well as apoptosis and the cell cycle. This protein has also been reported to have a role in cancer metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for one null allele exhibit impaired lymphocyte trafficking and a deficit of splenic marginal zone B cells. Mice homozygous for another null allele display impaired spatial learning and decreased hippocampal dendritic spine densities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,105,793 M88L probably benign Het
4933412E24Rik A G 15: 60,016,363 V76A possibly damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anapc4 T C 5: 52,841,937 probably benign Het
Anxa4 A G 6: 86,743,153 S144P probably benign Het
Bcr A G 10: 75,131,112 E517G probably damaging Het
Ccdc57 T C 11: 120,860,523 E907G probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Dock6 A G 9: 21,839,486 probably benign Het
Dock8 A G 19: 25,200,393 K2031E probably damaging Het
Gm5444 T C 13: 4,834,345 noncoding transcript Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifna16 A G 4: 88,676,328 S177P probably damaging Het
Ino80d T C 1: 63,065,826 N364D possibly damaging Het
Ltbp2 T C 12: 84,809,163 T769A probably benign Het
Mug1 T C 6: 121,884,629 V1350A probably benign Het
Olfr1098 T C 2: 86,922,638 K298R possibly damaging Het
Olfr1122 A T 2: 87,387,740 I12F probably benign Het
Olfr1201 A G 2: 88,794,645 N88D probably benign Het
Pole A T 5: 110,330,963 I28F possibly damaging Het
Prkce C A 17: 86,474,442 P180T probably damaging Het
Ralgapa1 T C 12: 55,677,124 H1995R possibly damaging Het
Rnf144b A G 13: 47,220,500 K58E probably benign Het
Rnf43 A G 11: 87,732,025 R651G probably damaging Het
Scel A T 14: 103,608,170 L580F possibly damaging Het
Scn4b G A 9: 45,147,829 V133M probably damaging Het
Sipa1l3 T C 7: 29,377,635 N904S probably damaging Het
Sun5 A G 2: 153,867,502 probably benign Het
Tanc2 T C 11: 105,835,051 V347A probably benign Het
Tmem245 T C 4: 56,937,957 Y197C probably damaging Het
Usp30 C T 5: 114,111,180 R182* probably null Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vps35 T C 8: 85,274,814 probably benign Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Ythdf3 A T 3: 16,203,215 probably benign Het
Zfp110 T C 7: 12,849,186 V587A probably benign Het
Other mutations in Nedd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Nedd9 APN 13 41316234 missense probably benign 0.00
IGL01412:Nedd9 APN 13 41315786 nonsense probably null
IGL01669:Nedd9 APN 13 41338635 missense probably damaging 0.99
IGL02543:Nedd9 APN 13 41316735 missense probably damaging 1.00
IGL03302:Nedd9 APN 13 41338854 missense probably damaging 0.99
hebei UTSW 13 41338979 nonsense probably null
sheep UTSW 13 41317962 missense probably benign 0.33
yanzhao UTSW 13 41311794 missense probably damaging 1.00
R1157:Nedd9 UTSW 13 41314503 intron probably null
R1611:Nedd9 UTSW 13 41316930 missense probably benign
R1669:Nedd9 UTSW 13 41311794 missense probably damaging 1.00
R1718:Nedd9 UTSW 13 41338926 missense probably damaging 1.00
R1775:Nedd9 UTSW 13 41317962 missense probably benign 0.33
R1971:Nedd9 UTSW 13 41338948 missense probably damaging 1.00
R2107:Nedd9 UTSW 13 41338979 nonsense probably null
R4362:Nedd9 UTSW 13 41317953 missense probably damaging 0.99
R4363:Nedd9 UTSW 13 41317953 missense probably damaging 0.99
R4707:Nedd9 UTSW 13 41338575 critical splice donor site probably null
R4724:Nedd9 UTSW 13 41316597 missense possibly damaging 0.50
R4795:Nedd9 UTSW 13 41317900 missense probably benign 0.12
R4796:Nedd9 UTSW 13 41317900 missense probably benign 0.12
R4853:Nedd9 UTSW 13 41316361 missense probably benign 0.01
R4934:Nedd9 UTSW 13 41338935 missense probably damaging 1.00
R5020:Nedd9 UTSW 13 41315794 missense probably damaging 1.00
R5070:Nedd9 UTSW 13 41316598 missense probably benign 0.00
R5585:Nedd9 UTSW 13 41316474 missense probably damaging 1.00
R5588:Nedd9 UTSW 13 41315961 missense possibly damaging 0.76
R6310:Nedd9 UTSW 13 41318452 missense probably benign 0.00
R6634:Nedd9 UTSW 13 41312108 missense probably damaging 1.00
R6729:Nedd9 UTSW 13 41315802 missense probably damaging 0.99
R7114:Nedd9 UTSW 13 41338623 missense probably benign
R7172:Nedd9 UTSW 13 41316804 missense probably benign 0.01
R7477:Nedd9 UTSW 13 41318480 missense probably benign 0.02
R7665:Nedd9 UTSW 13 41316309 missense probably benign 0.01
R7672:Nedd9 UTSW 13 41338722 missense possibly damaging 0.69
R7810:Nedd9 UTSW 13 41312007 missense possibly damaging 0.52
R7893:Nedd9 UTSW 13 41315789 missense probably damaging 1.00
R7976:Nedd9 UTSW 13 41315789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGGATCTCATTGATGTGCC -3'
(R):5'- AGTGATGCCTATGATGTCCCC -3'

Sequencing Primer
(F):5'- GATGTGCCTTTCCATGTATCCGTAG -3'
(R):5'- CCCGGGGAGTTCAGTTTC -3'
Posted On2014-10-30