Incidental Mutation 'R8399:Nedd9'
ID647785
Institutional Source Beutler Lab
Gene Symbol Nedd9
Ensembl Gene ENSMUSG00000021365
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 9
SynonymsE230025G09Rik, HEF1, Cas-L, CasL
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location41309581-41487362 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 41318474 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 176 (Y176*)
Ref Sequence ENSEMBL: ENSMUSP00000021794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021794] [ENSMUST00000163623] [ENSMUST00000224803]
Predicted Effect probably null
Transcript: ENSMUST00000021794
AA Change: Y176*
SMART Domains Protein: ENSMUSP00000021794
Gene: ENSMUSG00000021365
AA Change: Y176*

DomainStartEndE-ValueType
SH3 6 64 3.78e-17 SMART
internal_repeat_1 151 218 1.33e-7 PROSPERO
low complexity region 368 396 N/A INTRINSIC
Pfam:Serine_rich 403 561 3.2e-66 PFAM
Pfam:DUF3513 611 828 1.4e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163623
AA Change: Y176*
SMART Domains Protein: ENSMUSP00000125773
Gene: ENSMUSG00000021365
AA Change: Y176*

DomainStartEndE-ValueType
SH3 6 64 3.78e-17 SMART
internal_repeat_1 151 218 1.42e-7 PROSPERO
low complexity region 368 396 N/A INTRINSIC
Pfam:Serine_rich 403 559 2.7e-60 PFAM
Pfam:DUF3513 618 827 1e-81 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000224803
AA Change: Y170*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the CRK-associated substrates family. Members of this family are adhesion docking molecules that mediate protein-protein interactions for signal transduction pathways. This protein is a focal adhesion protein that acts as a scaffold to regulate signaling complexes important in cell attachment, migration and invasion as well as apoptosis and the cell cycle. This protein has also been reported to have a role in cancer metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for one null allele exhibit impaired lymphocyte trafficking and a deficit of splenic marginal zone B cells. Mice homozygous for another null allele display impaired spatial learning and decreased hippocampal dendritic spine densities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Klra17 T C 6: 129,874,937 probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Nedd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Nedd9 APN 13 41316234 missense probably benign 0.00
IGL01412:Nedd9 APN 13 41315786 nonsense probably null
IGL01669:Nedd9 APN 13 41338635 missense probably damaging 0.99
IGL02543:Nedd9 APN 13 41316735 missense probably damaging 1.00
IGL03302:Nedd9 APN 13 41338854 missense probably damaging 0.99
hebei UTSW 13 41338979 nonsense probably null
sheep UTSW 13 41317962 missense probably benign 0.33
yanzhao UTSW 13 41311794 missense probably damaging 1.00
R1157:Nedd9 UTSW 13 41314503 splice site probably null
R1611:Nedd9 UTSW 13 41316930 missense probably benign
R1669:Nedd9 UTSW 13 41311794 missense probably damaging 1.00
R1718:Nedd9 UTSW 13 41338926 missense probably damaging 1.00
R1775:Nedd9 UTSW 13 41317962 missense probably benign 0.33
R1971:Nedd9 UTSW 13 41338948 missense probably damaging 1.00
R2107:Nedd9 UTSW 13 41338979 nonsense probably null
R2341:Nedd9 UTSW 13 41316511 missense probably damaging 1.00
R4362:Nedd9 UTSW 13 41317953 missense probably damaging 0.99
R4363:Nedd9 UTSW 13 41317953 missense probably damaging 0.99
R4707:Nedd9 UTSW 13 41338575 critical splice donor site probably null
R4724:Nedd9 UTSW 13 41316597 missense possibly damaging 0.50
R4795:Nedd9 UTSW 13 41317900 missense probably benign 0.12
R4796:Nedd9 UTSW 13 41317900 missense probably benign 0.12
R4853:Nedd9 UTSW 13 41316361 missense probably benign 0.01
R4934:Nedd9 UTSW 13 41338935 missense probably damaging 1.00
R5020:Nedd9 UTSW 13 41315794 missense probably damaging 1.00
R5070:Nedd9 UTSW 13 41316598 missense probably benign 0.00
R5585:Nedd9 UTSW 13 41316474 missense probably damaging 1.00
R5588:Nedd9 UTSW 13 41315961 missense possibly damaging 0.76
R6310:Nedd9 UTSW 13 41318452 missense probably benign 0.00
R6634:Nedd9 UTSW 13 41312108 missense probably damaging 1.00
R6729:Nedd9 UTSW 13 41315802 missense probably damaging 0.99
R7114:Nedd9 UTSW 13 41338623 missense probably benign
R7172:Nedd9 UTSW 13 41316804 missense probably benign 0.01
R7477:Nedd9 UTSW 13 41318480 missense probably benign 0.02
R7665:Nedd9 UTSW 13 41316309 missense probably benign 0.01
R7672:Nedd9 UTSW 13 41338722 missense possibly damaging 0.69
R7810:Nedd9 UTSW 13 41312007 missense possibly damaging 0.52
R7893:Nedd9 UTSW 13 41315789 missense probably damaging 1.00
R7952:Nedd9 UTSW 13 41316955 missense probably damaging 1.00
R8215:Nedd9 UTSW 13 41338843 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCAACACCGACTGAAATGGC -3'
(R):5'- AGTGCCCTTAACTGCTGATCC -3'

Sequencing Primer
(F):5'- ACTGAAATGGCCTCTGGAC -3'
(R):5'- CCTTGAATATAGGGAATTGAGAGTCC -3'
Posted On2020-09-02