Incidental Mutation 'R2384:Tmem232'
ID247663
Institutional Source Beutler Lab
Gene Symbol Tmem232
Ensembl Gene ENSMUSG00000045036
Gene Nametransmembrane protein 232
SynonymsLOC381107, E130009J12Rik
MMRRC Submission 040358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2384 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location65256005-65540782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65402857 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 479 (R479W)
Ref Sequence ENSEMBL: ENSMUSP00000083927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062161] [ENSMUST00000086722]
Predicted Effect probably damaging
Transcript: ENSMUST00000062161
AA Change: R479W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055652
Gene: ENSMUSG00000045036
AA Change: R479W

DomainStartEndE-ValueType
Pfam:TMEM232 40 488 5.3e-235 PFAM
coiled coil region 598 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086722
AA Change: R479W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083927
Gene: ENSMUSG00000045036
AA Change: R479W

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
coiled coil region 598 634 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933414I15Rik A G 11: 50,942,506 S90P unknown Het
Abca13 T C 11: 9,267,450 probably benign Het
Chpf C T 1: 75,475,109 R567H probably benign Het
Cnp A G 11: 100,576,453 Y74C probably damaging Het
Cul3 A T 1: 80,283,689 V273D probably damaging Het
Dnmt3a A G 12: 3,901,591 Y656C probably damaging Het
Erich3 A T 3: 154,764,651 E107V possibly damaging Het
Fscn2 T C 11: 120,366,733 S307P possibly damaging Het
Gm156 T A 6: 129,772,380 H84L probably benign Het
Grm5 A G 7: 87,602,728 E62G probably damaging Het
Hdac4 T C 1: 91,984,485 Y394C probably benign Het
Hipk2 A G 6: 38,818,371 I314T probably damaging Het
Hsd17b12 T A 2: 94,033,619 I293L probably benign Het
Il1f9 A G 2: 24,192,648 H145R probably benign Het
Ints12 T A 3: 133,109,103 probably null Het
Khdrbs2 T C 1: 32,519,895 S369G probably damaging Het
Mup5 T A 4: 61,835,024 probably null Het
Nlrp4g A G 9: 124,349,707 noncoding transcript Het
Obscn A G 11: 59,042,837 probably null Het
Ogdh C A 11: 6,342,526 A413D probably damaging Het
Podn T C 4: 108,022,072 E283G probably damaging Het
Ppp1r32 A C 19: 10,481,282 probably null Het
Ripk1 A G 13: 34,030,043 D456G probably benign Het
Scg3 T C 9: 75,665,726 T308A probably damaging Het
Sele A G 1: 164,050,775 T228A probably benign Het
Slc41a3 A G 6: 90,626,411 E138G probably damaging Het
Tmem161a T C 8: 70,177,554 V104A probably benign Het
Trim26 C T 17: 36,850,889 P67S probably damaging Het
Trpm8 A G 1: 88,359,656 Y787C probably benign Het
Ttc28 T A 5: 111,276,208 V1447D possibly damaging Het
Uaca G A 9: 60,869,917 A527T probably damaging Het
Ucp2 A G 7: 100,498,254 I172V probably benign Het
Zzef1 T A 11: 72,858,394 Y903N probably damaging Het
Other mutations in Tmem232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Tmem232 APN 17 65256574 missense possibly damaging 0.71
IGL00954:Tmem232 APN 17 65500153 missense probably damaging 1.00
IGL01530:Tmem232 APN 17 65256548 nonsense probably null
IGL02881:Tmem232 APN 17 65450370 missense probably damaging 1.00
IGL02969:Tmem232 APN 17 65256563 missense possibly damaging 0.69
IGL02972:Tmem232 APN 17 65476673 missense probably benign 0.00
IGL03028:Tmem232 APN 17 65256389 missense probably benign 0.14
IGL03293:Tmem232 APN 17 65450374 missense probably damaging 1.00
R0380:Tmem232 UTSW 17 65256448 missense probably benign 0.23
R0432:Tmem232 UTSW 17 65256503 missense probably damaging 0.99
R0524:Tmem232 UTSW 17 65485942 missense probably damaging 0.98
R0548:Tmem232 UTSW 17 65382620 missense probably benign 0.22
R1345:Tmem232 UTSW 17 65450406 missense possibly damaging 0.60
R1521:Tmem232 UTSW 17 65484501 missense probably damaging 0.99
R1954:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R1955:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R2012:Tmem232 UTSW 17 65500172 missense probably benign 0.21
R2294:Tmem232 UTSW 17 65450441 missense probably benign 0.00
R2369:Tmem232 UTSW 17 65402997 missense probably damaging 1.00
R2894:Tmem232 UTSW 17 65450413 missense probably damaging 1.00
R3431:Tmem232 UTSW 17 65265302 splice site probably null
R3788:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R3789:Tmem232 UTSW 17 65382525 missense probably benign 0.02
R3789:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R4155:Tmem232 UTSW 17 65436333 missense probably damaging 0.97
R4691:Tmem232 UTSW 17 65265242 missense possibly damaging 0.88
R4838:Tmem232 UTSW 17 65430888 missense probably benign 0.04
R5340:Tmem232 UTSW 17 65402998 missense possibly damaging 0.92
R5619:Tmem232 UTSW 17 65486511 missense probably benign 0.06
R6176:Tmem232 UTSW 17 65485872 missense probably damaging 1.00
R6192:Tmem232 UTSW 17 65430805 missense probably damaging 1.00
R6223:Tmem232 UTSW 17 65500196 start codon destroyed probably null 0.99
R6256:Tmem232 UTSW 17 65478402 missense possibly damaging 0.89
R6782:Tmem232 UTSW 17 65500124 missense possibly damaging 0.88
R6856:Tmem232 UTSW 17 65450310 missense possibly damaging 0.57
R7262:Tmem232 UTSW 17 65500117 missense probably benign
R7459:Tmem232 UTSW 17 65256389 missense probably benign 0.14
R7699:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
R7700:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
R8284:Tmem232 UTSW 17 65402995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCGTGGCCTGGTGATATG -3'
(R):5'- ATCATCATCGTCCCTGCAGG -3'

Sequencing Primer
(F):5'- ATAATGTCGTCCGGAACTTGGCTC -3'
(R):5'- ATCGTCCCTGCAGGTGAGAAG -3'
Posted On2014-11-11