Incidental Mutation 'R0308:Erich6'
ID24949
Institutional Source Beutler Lab
Gene Symbol Erich6
Ensembl Gene ENSMUSG00000070471
Gene Nameglutamate rich 6
SynonymsFam194a, 4932431H17Rik
MMRRC Submission 038518-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R0308 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location58616300-58637207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58636104 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 182 (F182L)
Ref Sequence ENSEMBL: ENSMUSP00000040882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041115]
Predicted Effect probably damaging
Transcript: ENSMUST00000041115
AA Change: F182L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040882
Gene: ENSMUSG00000070471
AA Change: F182L

DomainStartEndE-ValueType
coiled coil region 27 77 N/A INTRINSIC
low complexity region 164 174 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
Pfam:FAM194 473 675 5.4e-67 PFAM
Meta Mutation Damage Score 0.1085 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,989 D65V probably damaging Het
4933407L21Rik A T 1: 85,931,286 probably benign Het
Abcc12 C T 8: 86,557,752 probably benign Het
Adamts12 A G 15: 11,311,560 E1301G probably damaging Het
Adh4 A T 3: 138,424,102 N230Y probably damaging Het
Anapc15-ps T A 10: 95,673,092 M109L probably benign Het
Angpt2 T C 8: 18,692,125 I472V possibly damaging Het
Arhgef26 C A 3: 62,340,399 D301E probably benign Het
Armc10 G A 5: 21,647,297 probably benign Het
Arntl A T 7: 113,291,536 I179F probably damaging Het
Atm T C 9: 53,454,473 probably null Het
Atp5b T C 10: 128,086,039 V265A probably benign Het
Atp8b1 G T 18: 64,545,244 C860* probably null Het
Atrnl1 T G 19: 57,753,288 S1160A probably benign Het
Cep55 A G 19: 38,060,211 E105G possibly damaging Het
Cfap54 C A 10: 92,885,364 D2502Y unknown Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Clptm1l A G 13: 73,611,667 D282G possibly damaging Het
Csrp1 C A 1: 135,745,286 T47N probably damaging Het
Cyp2c40 T A 19: 39,777,988 I388F probably damaging Het
Dars C T 1: 128,364,259 R494H probably damaging Het
Dna2 T C 10: 62,956,974 V256A probably damaging Het
Dock7 T C 4: 98,984,814 T1132A probably benign Het
Elk3 A T 10: 93,265,205 M228K probably benign Het
Fhad1 A G 4: 141,985,593 probably benign Het
Fryl A T 5: 73,041,604 probably benign Het
Fzd9 A T 5: 135,249,406 C542S probably damaging Het
Gba A G 3: 89,208,364 T460A probably benign Het
Gli2 C T 1: 118,842,062 A587T probably benign Het
Gm10037 A G 13: 67,843,113 probably benign Het
Gm11011 C T 2: 169,582,694 probably benign Het
Gm17018 T G 19: 45,577,006 F140V probably damaging Het
Gm9745 T G 13: 8,940,841 probably benign Het
Gmppb A G 9: 108,049,834 E68G probably benign Het
Gpld1 A G 13: 24,962,835 N260S possibly damaging Het
Hipk3 G A 2: 104,433,207 S900L probably damaging Het
Ints6l A T X: 56,481,355 M215L possibly damaging Het
Irx6 T A 8: 92,677,031 L128Q probably damaging Het
Itga10 T C 3: 96,651,464 S373P probably damaging Het
Jak1 T C 4: 101,154,535 probably null Het
Jak2 C T 19: 29,311,757 T1103I probably benign Het
Katnal1 A T 5: 148,878,924 V401D possibly damaging Het
Lrp2 T A 2: 69,482,982 probably benign Het
Map3k13 A G 16: 21,891,988 H7R probably benign Het
Mrgprx3-ps A G 7: 47,310,018 V75A probably benign Het
Nol6 C T 4: 41,123,584 A55T probably benign Het
Olfr881 A G 9: 37,992,845 I118V probably benign Het
Opa1 G A 16: 29,621,531 R818Q probably damaging Het
Opn4 T C 14: 34,597,124 Y168C possibly damaging Het
Phf21a T C 2: 92,330,777 V330A possibly damaging Het
Phykpl A G 11: 51,593,596 probably benign Het
Plcb1 T G 2: 134,813,614 V38G probably benign Het
Plxna4 T A 6: 32,237,768 T593S probably benign Het
Poll A T 19: 45,555,965 I339N probably damaging Het
Rev3l A G 10: 39,824,894 I1796V probably benign Het
Rnf103 G A 6: 71,509,702 R439H probably damaging Het
Rrn3 G A 16: 13,799,882 probably benign Het
Sec14l4 G A 11: 4,041,726 probably benign Het
Sec23a A C 12: 59,007,199 Y4* probably null Het
Senp6 T C 9: 80,132,983 probably null Het
Serpinb6b A T 13: 32,978,237 N221Y probably benign Het
Slc6a2 A G 8: 92,961,360 E38G possibly damaging Het
Smap1 A T 1: 23,849,342 L196I probably damaging Het
Sorbs2 C T 8: 45,795,130 Q473* probably null Het
Sphkap C A 1: 83,276,969 V1020F probably damaging Het
Srfbp1 T C 18: 52,488,542 V225A probably benign Het
Srprb G A 9: 103,202,005 P728S possibly damaging Het
Tarm1 T C 7: 3,496,671 probably benign Het
Tcp1 T A 17: 12,920,419 I162N probably benign Het
Tmem237 C A 1: 59,107,517 A292S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnpo1 A G 13: 98,846,503 F884L probably damaging Het
Trim7 A G 11: 48,849,501 T142A probably damaging Het
Ttn T A 2: 76,785,680 I14894F probably damaging Het
Tubgcp6 T C 15: 89,122,436 R128G possibly damaging Het
Ube2d2b A G 5: 107,830,908 T142A possibly damaging Het
Unc13c G T 9: 73,481,118 L2129I probably benign Het
Ushbp1 T C 8: 71,391,053 D247G probably damaging Het
Usp43 G A 11: 67,880,140 A556V probably damaging Het
Zfp438 T A 18: 5,213,638 H440L probably benign Het
Zfp518b C T 5: 38,672,770 E631K possibly damaging Het
Other mutations in Erich6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Erich6 APN 3 58637043 missense unknown
IGL01352:Erich6 APN 3 58622360 splice site probably null
IGL01362:Erich6 APN 3 58622360 splice site probably null
IGL01928:Erich6 APN 3 58621271 missense probably damaging 1.00
IGL02930:Erich6 APN 3 58622354 splice site probably benign
IGL03125:Erich6 APN 3 58624306 missense probably benign 0.00
PIT4243001:Erich6 UTSW 3 58629879 missense possibly damaging 0.51
R0081:Erich6 UTSW 3 58636126 splice site probably benign
R0129:Erich6 UTSW 3 58624378 missense probably damaging 1.00
R0682:Erich6 UTSW 3 58636811 missense probably benign 0.39
R0734:Erich6 UTSW 3 58629388 splice site probably benign
R0744:Erich6 UTSW 3 58636122 splice site probably benign
R0833:Erich6 UTSW 3 58618944 splice site probably benign
R0836:Erich6 UTSW 3 58618944 splice site probably benign
R1385:Erich6 UTSW 3 58636830 missense probably benign 0.00
R1536:Erich6 UTSW 3 58626598 missense probably benign 0.01
R1570:Erich6 UTSW 3 58630659 critical splice donor site probably null
R1708:Erich6 UTSW 3 58616447 missense probably benign 0.21
R2187:Erich6 UTSW 3 58629845 critical splice donor site probably null
R2268:Erich6 UTSW 3 58618839 missense probably benign 0.03
R2441:Erich6 UTSW 3 58618811 missense probably damaging 1.00
R3803:Erich6 UTSW 3 58621332 missense probably damaging 1.00
R3981:Erich6 UTSW 3 58636704 missense probably benign 0.41
R4166:Erich6 UTSW 3 58618808 missense probably damaging 1.00
R4298:Erich6 UTSW 3 58624291 missense probably benign 0.09
R4729:Erich6 UTSW 3 58636059 critical splice donor site probably null
R4838:Erich6 UTSW 3 58636830 missense probably benign 0.00
R5117:Erich6 UTSW 3 58623205 missense probably benign 0.00
R5305:Erich6 UTSW 3 58625116 missense probably benign 0.21
R5546:Erich6 UTSW 3 58618797 missense probably benign 0.39
R5605:Erich6 UTSW 3 58625119 missense probably damaging 1.00
R6033:Erich6 UTSW 3 58623201 missense probably benign 0.16
R6033:Erich6 UTSW 3 58623201 missense probably benign 0.16
R6378:Erich6 UTSW 3 58622359 splice site probably null
R6606:Erich6 UTSW 3 58616500 missense probably damaging 1.00
R6736:Erich6 UTSW 3 58625054 missense probably damaging 1.00
R6746:Erich6 UTSW 3 58616566 missense possibly damaging 0.69
R6974:Erich6 UTSW 3 58618799 missense probably benign 0.06
R6996:Erich6 UTSW 3 58636095 missense probably damaging 1.00
R7317:Erich6 UTSW 3 58636884 missense probably benign 0.26
R7484:Erich6 UTSW 3 58626691 splice site probably null
R7526:Erich6 UTSW 3 58630689 missense probably damaging 1.00
R7747:Erich6 UTSW 3 58618928 missense probably damaging 1.00
R7947:Erich6 UTSW 3 58621278 missense possibly damaging 0.63
R8358:Erich6 UTSW 3 58637028 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCCATTGATCCCAACTTAGCTTC -3'
(R):5'- ACACGCAGCGTTACTGTCTTCC -3'

Sequencing Primer
(F):5'- ggagagatggctcagcag -3'
(R):5'- CAGAGCATTTAGAACGAGCTTC -3'
Posted On2013-04-16