Incidental Mutation 'R2436:Tnfrsf17'
ID249603
Institutional Source Beutler Lab
Gene Symbol Tnfrsf17
Ensembl Gene ENSMUSG00000022496
Gene Nametumor necrosis factor receptor superfamily, member 17
SynonymsBCM, Tnfrsf13a, Tnfrsf13
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2436 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location11313812-11320074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11319812 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 138 (D138N)
Ref Sequence ENSEMBL: ENSMUSP00000023140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023140] [ENSMUST00000115814] [ENSMUST00000180792]
Predicted Effect probably damaging
Transcript: ENSMUST00000023140
AA Change: D138N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023140
Gene: ENSMUSG00000022496
AA Change: D138N

DomainStartEndE-ValueType
Pfam:BCMA-Tall_bind 5 40 4.2e-23 PFAM
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115814
SMART Domains Protein: ENSMUSP00000111481
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 64 74 N/A INTRINSIC
RUN 115 178 7.89e-26 SMART
internal_repeat_1 192 211 2.98e-5 PROSPERO
internal_repeat_1 203 222 2.98e-5 PROSPERO
low complexity region 252 262 N/A INTRINSIC
low complexity region 270 275 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180792
SMART Domains Protein: ENSMUSP00000138025
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 64 74 N/A INTRINSIC
RUN 115 178 7.89e-26 SMART
internal_repeat_1 192 211 2.63e-5 PROSPERO
internal_repeat_1 203 222 2.63e-5 PROSPERO
low complexity region 252 262 N/A INTRINSIC
low complexity region 270 275 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
coiled coil region 467 548 N/A INTRINSIC
PX 661 764 3.13e-9 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B/TALL-1/BAFF), and to lead to NF-kappaB and MAPK8/JNK activation. This receptor also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted null mutations in this gene are viable and fertile with no apparent defects in immune system development or function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,761,945 S277P possibly damaging Het
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Barx2 T C 9: 31,913,087 H2R probably damaging Het
Calhm3 T C 19: 47,151,965 T230A probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Hmgxb3 T C 18: 61,147,494 T646A probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nme8 A G 13: 19,677,859 F200S probably damaging Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Slc16a9 TCCCC TCCCCC 10: 70,256,081 probably null Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tcaf3 G A 6: 42,593,729 A363V probably damaging Het
Tmem138 A G 19: 10,574,904 F78S probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Usp24 T A 4: 106,409,645 L1875* probably null Het
Vmn2r109 C A 17: 20,554,536 G186C probably damaging Het
Wdr78 T C 4: 103,066,352 I427V probably benign Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Tnfrsf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Tnfrsf17 APN 16 11313947 utr 5 prime probably benign
IGL02880:Tnfrsf17 APN 16 11319758 missense probably damaging 1.00
R0514:Tnfrsf17 UTSW 16 11315327 missense probably benign
R0659:Tnfrsf17 UTSW 16 11319819 missense probably damaging 1.00
R0764:Tnfrsf17 UTSW 16 11315199 missense possibly damaging 0.52
R1463:Tnfrsf17 UTSW 16 11315202 missense possibly damaging 0.93
R1716:Tnfrsf17 UTSW 16 11319731 missense probably benign 0.15
R4658:Tnfrsf17 UTSW 16 11313969 missense probably benign 0.08
R6440:Tnfrsf17 UTSW 16 11319890 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCATGGCATGACAATACC -3'
(R):5'- GCTCTCCTGACAGAAGGTTC -3'

Sequencing Primer
(F):5'- TGGCATGACAATACCACTGAG -3'
(R):5'- GAAGGTTCTCAAAGCAGCTTC -3'
Posted On2014-11-12