Incidental Mutation 'R2428:Wdr53'
ID250323
Institutional Source Beutler Lab
Gene Symbol Wdr53
Ensembl Gene ENSMUSG00000022787
Gene NameWD repeat domain 53
Synonyms1500002B03Rik
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2428 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32247227-32257083 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32252190 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 118 (I118V)
Ref Sequence ENSEMBL: ENSMUSP00000135908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023474] [ENSMUST00000135289] [ENSMUST00000141820] [ENSMUST00000178573]
Predicted Effect probably benign
Transcript: ENSMUST00000023474
AA Change: I118V

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023474
Gene: ENSMUSG00000022787
AA Change: I118V

DomainStartEndE-ValueType
WD40 1 37 1.14e2 SMART
WD40 83 122 9.94e-1 SMART
WD40 125 165 3.09e-5 SMART
WD40 188 225 1.65e1 SMART
WD40 228 269 1.86e-8 SMART
Blast:WD40 314 354 4e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135289
Predicted Effect probably benign
Transcript: ENSMUST00000141820
AA Change: I118V

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000178573
AA Change: I118V

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135908
Gene: ENSMUSG00000022787
AA Change: I118V

DomainStartEndE-ValueType
WD40 1 37 1.14e2 SMART
WD40 83 122 9.94e-1 SMART
WD40 125 165 3.09e-5 SMART
WD40 188 225 1.65e1 SMART
WD40 228 269 1.86e-8 SMART
Blast:WD40 314 354 4e-11 BLAST
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing WD domains. The function of this gene is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Wdr53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Wdr53 APN 16 32256497 nonsense probably null
IGL01399:Wdr53 APN 16 32251900 missense possibly damaging 0.68
R0041:Wdr53 UTSW 16 32256655 missense probably damaging 1.00
R0582:Wdr53 UTSW 16 32251908 missense probably damaging 0.96
R1750:Wdr53 UTSW 16 32252117 missense probably damaging 1.00
R1883:Wdr53 UTSW 16 32256498 missense possibly damaging 0.93
R3726:Wdr53 UTSW 16 32256720 missense probably benign 0.01
R4495:Wdr53 UTSW 16 32252151 missense probably benign 0.04
R4883:Wdr53 UTSW 16 32256978 nonsense probably null
R4884:Wdr53 UTSW 16 32256978 nonsense probably null
R4905:Wdr53 UTSW 16 32256658 missense probably benign 0.03
R6031:Wdr53 UTSW 16 32256718 missense probably damaging 1.00
R6031:Wdr53 UTSW 16 32256718 missense probably damaging 1.00
R6222:Wdr53 UTSW 16 32256664 missense probably benign 0.01
Z1088:Wdr53 UTSW 16 32252298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGATGGGACCCCGTTAG -3'
(R):5'- TGCTCAGAAATTACCCAAATGC -3'

Sequencing Primer
(F):5'- CCCGTTAGGACACATGCAATTGG -3'
(R):5'- CAGAAATTACCCAAATGCTCTTTGC -3'
Posted On2014-11-12