Incidental Mutation 'R0309:Calr'
ID25074
Institutional Source Beutler Lab
Gene Symbol Calr
Ensembl Gene ENSMUSG00000003814
Gene Namecalreticulin
SynonymsCalregulin, CRT
MMRRC Submission 038519-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0309 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84841850-84846934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84843031 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 322 (K322N)
Ref Sequence ENSEMBL: ENSMUSP00000003912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003911] [ENSMUST00000003912] [ENSMUST00000109761] [ENSMUST00000128035]
PDB Structure
Crystal structure of the calreticulin lectin domain [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural and functional relationships between the lectin and arm domains of calreticulin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000003911
SMART Domains Protein: ENSMUSP00000003911
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 229 272 5.7e-8 SMART
low complexity region 296 307 N/A INTRINSIC
UBA 319 356 9.11e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000003912
AA Change: K322N

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003912
Gene: ENSMUSG00000003814
AA Change: K322N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Calreticulin 23 258 2.7e-64 PFAM
Pfam:Calreticulin 257 332 3.3e-24 PFAM
low complexity region 358 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109761
SMART Domains Protein: ENSMUSP00000105383
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 230 273 5.7e-8 SMART
low complexity region 297 308 N/A INTRINSIC
UBA 320 357 9.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128028
Predicted Effect probably benign
Transcript: ENSMUST00000128035
SMART Domains Protein: ENSMUSP00000115664
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 230 273 5.7e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141347
Predicted Effect probably benign
Transcript: ENSMUST00000144675
SMART Domains Protein: ENSMUSP00000114431
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
SCOP:d1ifya_ 2 18 3e-3 SMART
STI1 44 87 5.7e-8 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154774
Meta Mutation Damage Score 0.2633 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.6%
  • 10x: 94.3%
  • 20x: 86.4%
Validation Efficiency 98% (125/127)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calreticulin is a multifunctional protein that acts as a major Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. It is also found in the nucleus, suggesting that it may have a role in transcription regulation. Calreticulin binds to the synthetic peptide KLGFFKR, which is almost identical to an amino acid sequence in the DNA-binding domain of the superfamily of nuclear receptors. Calreticulin binds to antibodies in certain sera of systemic lupus and Sjogren patients which contain anti-Ro/SSA antibodies, it is highly conserved among species, and it is located in the endoplasmic and sarcoplasmic reticulum where it may bind calcium. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin can inhibit the binding of androgen receptor to its hormone-responsive DNA element and can inhibit androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Thus, calreticulin can act as an important modulator of the regulation of gene transcription by nuclear hormone receptors. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin but calreticulin is not a Ro/SS-A antigen. Earlier papers referred to calreticulin as an Ro/SS-A antigen but this was later disproven. Increased autoantibody titer against human calreticulin is found in infants with complete congenital heart block of both the IgG and IgM classes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit decreased cardiac cell mass, increased apoptosis of cardiac myocytes, neural tube defects (sometimes associated with exencephaly), omphalocele, and mid- to late-gestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,259 D133G possibly damaging Het
Abcb4 A C 5: 8,939,835 D796A probably damaging Het
Actg2 A T 6: 83,519,914 V147E probably damaging Het
Adamts13 A C 2: 26,986,989 T534P probably damaging Het
Ago1 T C 4: 126,443,166 T249A probably benign Het
Ahnak T A 19: 9,002,495 I381N probably damaging Het
Akap9 A G 5: 4,069,038 D3515G probably benign Het
Angptl3 T C 4: 99,034,469 V249A probably benign Het
Ank A G 15: 27,567,572 T294A possibly damaging Het
Ank1 A T 8: 23,104,809 H204L probably damaging Het
Apbb2 A G 5: 66,310,988 probably benign Het
Arhgap28 A T 17: 67,901,429 S15T probably benign Het
Aspm T C 1: 139,482,511 probably benign Het
Atp1a4 T C 1: 172,234,987 E651G probably damaging Het
B3gnt2 A T 11: 22,836,860 F109L probably damaging Het
Bpifb4 T C 2: 153,959,683 F575L probably damaging Het
Ccdc188 T C 16: 18,219,305 S247P possibly damaging Het
Cdr1 T A X: 61,185,302 D86V unknown Het
Cep97 C T 16: 55,925,058 V48I probably damaging Het
Chaf1b T A 16: 93,884,511 C6S probably damaging Het
Chd3 C T 11: 69,357,018 D920N probably damaging Het
Clk1 T C 1: 58,413,033 probably benign Het
Cntnap3 T A 13: 64,757,436 probably benign Het
Col12a1 T A 9: 79,600,011 probably null Het
Col17a1 G T 19: 47,671,362 probably benign Het
Coq7 T A 7: 118,529,717 I32F possibly damaging Het
Cox6a2 A T 7: 128,205,935 F59I probably damaging Het
Cpq A G 15: 33,594,151 D436G probably damaging Het
Ctso G A 3: 81,944,861 probably null Het
Cxadr A T 16: 78,334,948 H274L probably benign Het
Cyp2c40 A T 19: 39,778,051 C367S possibly damaging Het
Cyp2c70 T G 19: 40,160,671 M344L possibly damaging Het
Defa35 G A 8: 21,065,855 V77I probably benign Het
Dhx57 A G 17: 80,274,881 Y432H probably damaging Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah7a C G 1: 53,405,690 D3952H probably damaging Het
Dnah9 C A 11: 66,026,972 probably benign Het
Dstyk C A 1: 132,456,864 probably benign Het
Efcab2 T A 1: 178,475,904 probably benign Het
Ehbp1l1 T C 19: 5,720,570 E287G possibly damaging Het
Epgn A G 5: 91,032,214 T87A probably benign Het
Erc2 A C 14: 28,141,225 E803A probably damaging Het
Fam26d A G 10: 34,044,047 W75R probably damaging Het
Fer A G 17: 64,139,016 *454W probably null Het
Glyr1 T C 16: 5,031,972 D179G probably damaging Het
Gm12830 T A 4: 114,844,976 probably benign Het
Gm14085 A T 2: 122,517,553 T253S probably benign Het
Gm9922 C A 14: 101,729,693 probably benign Het
Gsta3 C T 1: 21,264,894 P200S possibly damaging Het
Hmgxb3 G A 18: 61,155,128 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il16 T C 7: 83,722,554 K15E probably damaging Het
Kcnip2 T A 19: 45,794,075 probably benign Het
Kdm4c T C 4: 74,345,567 V696A probably benign Het
Kdr A G 5: 75,946,927 probably benign Het
Klhl33 T G 14: 50,891,411 H787P probably damaging Het
Klk14 A T 7: 43,694,345 T159S probably benign Het
Lancl2 A G 6: 57,703,132 N16D probably damaging Het
Lemd3 T C 10: 120,937,110 N583S possibly damaging Het
Map3k4 TGCTGGCTTCAGGGCCACAGTCCGCTG TGCTG 17: 12,271,015 probably null Het
Mpl T G 4: 118,446,038 probably benign Het
Myh7b T C 2: 155,630,672 probably benign Het
Mylk A C 16: 34,912,297 probably benign Het
Myof A T 19: 37,981,266 M316K probably benign Het
Nfib T A 4: 82,296,737 N543I probably damaging Het
Nfix A G 8: 84,721,774 S375P probably damaging Het
Nkrf T C X: 36,890,116 Q171R probably damaging Het
Nmnat2 T A 1: 153,077,001 probably benign Het
Npffr2 G A 5: 89,583,347 E379K probably benign Het
Npr2 T C 4: 43,640,904 probably benign Het
Nup98 A C 7: 102,152,428 D212E probably null Het
Nwd2 T C 5: 63,807,218 Y1382H probably damaging Het
Ocstamp T C 2: 165,395,992 R451G possibly damaging Het
Olfr593 T A 7: 103,212,721 I287K probably damaging Het
Olfr804 A G 10: 129,705,139 D87G probably benign Het
Pabpc1 C T 15: 36,597,493 A551T possibly damaging Het
Papd7 A T 13: 69,499,932 V781E possibly damaging Het
Pard3 A T 8: 127,376,897 probably benign Het
Pcdhb12 G T 18: 37,436,121 V107L probably benign Het
Pik3cd A T 4: 149,663,220 V22D probably damaging Het
Pkd1l2 A G 8: 116,997,576 V2396A probably damaging Het
Pnpla7 T C 2: 24,987,195 I167T probably damaging Het
Pphln1 A T 15: 93,441,707 H114L possibly damaging Het
Ppm1h A G 10: 122,920,782 N444S probably damaging Het
Prdm9 G A 17: 15,557,384 T146I probably damaging Het
Prrc2a A G 17: 35,150,915 probably benign Het
Prrx1 T C 1: 163,312,559 D26G possibly damaging Het
Ptpn5 T C 7: 47,079,294 E495G probably damaging Het
Rab23 A C 1: 33,734,861 probably null Het
Ralgps1 C T 2: 33,157,923 M348I probably benign Het
Ranbp2 A G 10: 58,479,868 T2137A probably benign Het
Rapgef4 G T 2: 72,226,030 G654V probably benign Het
Rc3h2 A T 2: 37,379,008 probably benign Het
Reg2 G A 6: 78,406,186 A39T possibly damaging Het
Sema4d C A 13: 51,725,311 V7F probably benign Het
Sgip1 T C 4: 102,915,157 probably benign Het
Sgpl1 C T 10: 61,113,437 probably null Het
Shisa9 G A 16: 11,997,123 V212M probably damaging Het
Shq1 G A 6: 100,573,627 P450L probably benign Het
Sin3a A G 9: 57,110,912 T872A probably benign Het
Sipa1l3 C T 7: 29,348,350 R1371Q probably benign Het
Skint8 T C 4: 111,938,867 V246A probably benign Het
Slc22a20 A T 19: 5,972,957 V386D probably damaging Het
Slc2a7 G A 4: 150,158,071 probably benign Het
Slc35a2 T A X: 7,889,662 Y48N probably damaging Het
Slc4a2 G T 5: 24,434,346 S413I probably damaging Het
Sntg2 T C 12: 30,226,773 T427A probably benign Het
Soat1 T C 1: 156,442,453 Y132C probably damaging Het
Stn1 G T 19: 47,501,673 H342N probably benign Het
Tarbp1 T A 8: 126,438,928 probably benign Het
Tas2r113 A C 6: 132,893,378 K123T probably damaging Het
Tbck C T 3: 132,734,407 Q504* probably null Het
Tenm3 C T 8: 48,341,034 C380Y probably damaging Het
Triobp A G 15: 78,976,540 D1389G probably damaging Het
Trpm4 A T 7: 45,308,706 F780I probably damaging Het
Tubb4a G T 17: 57,081,182 Y281* probably null Het
Txndc15 T C 13: 55,724,582 F261S probably damaging Het
Ube3b T C 5: 114,419,469 probably benign Het
Unc5c G C 3: 141,733,933 V196L probably benign Het
Upf3a G A 8: 13,795,500 probably null Het
Vmn2r20 T C 6: 123,386,104 K574E probably benign Het
Vps50 A G 6: 3,536,853 M275V possibly damaging Het
Xrcc5 A G 1: 72,307,576 probably benign Het
Zbtb18 T C 1: 177,448,616 L505S probably damaging Het
Zbtb41 T C 1: 139,438,984 I567T probably damaging Het
Zfp598 T C 17: 24,678,584 probably benign Het
Other mutations in Calr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Calr APN 8 84844744 missense possibly damaging 0.89
IGL00648:Calr APN 8 84842702 unclassified probably benign
IGL01309:Calr APN 8 84846706 critical splice donor site probably null
IGL01910:Calr APN 8 84844969 unclassified probably benign
IGL01918:Calr APN 8 84842850 unclassified probably benign
IGL02399:Calr APN 8 84842786 unclassified probably benign
IGL02749:Calr APN 8 84844488 missense probably damaging 1.00
IGL02858:Calr APN 8 84844899 missense probably benign 0.07
IGL03090:Calr APN 8 84846744 missense possibly damaging 0.82
K3955:Calr UTSW 8 84846273 missense probably damaging 1.00
R1670:Calr UTSW 8 84844119 missense probably benign 0.24
R1974:Calr UTSW 8 84844157 missense probably benign
R6864:Calr UTSW 8 84844928 missense probably damaging 0.98
R7120:Calr UTSW 8 84842828 missense probably damaging 0.98
Z1176:Calr UTSW 8 84844064 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- AAATCTGTCTGCCAGTCCTCCCAG -3'
(R):5'- GTAATGCTCCCAGGATCACAGCTC -3'

Sequencing Primer
(F):5'- GCCAGTCCTCCCAGATGAC -3'
(R):5'- acctccacaagtagtctgtcttc -3'
Posted On2013-04-16