Incidental Mutation 'R0309:Aspm'
ID 25020
Institutional Source Beutler Lab
Gene Symbol Aspm
Ensembl Gene ENSMUSG00000033952
Gene Name abnormal spindle microtubule assembly
Synonyms Aspm, Sha1, MCPH5, D330028K02Rik, Calmbp1
MMRRC Submission 038519-MU
Accession Numbers

Genbank: NM_009791; MGI: 1334448

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0309 (G1)
Quality Score 164
Status Validated
Chromosome 1
Chromosomal Location 139454772-139494091 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 139482511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053364
SMART Domains Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952

Pfam:ASH 29 126 8.9e-35 PFAM
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 2.41e-4 SMART
IQ 1360 1382 2.12e1 SMART
IQ 1387 1408 7.61e1 SMART
IQ 1409 1431 6.97e0 SMART
IQ 1432 1452 1.44e1 SMART
IQ 1453 1475 1.15e-1 SMART
IQ 1476 1495 1.66e2 SMART
IQ 1503 1525 1.65e-2 SMART
IQ 1526 1548 1.32e1 SMART
IQ 1549 1571 1.48e1 SMART
IQ 1572 1594 2.5e1 SMART
IQ 1599 1621 2.58e-4 SMART
IQ 1622 1644 6.7e-3 SMART
IQ 1645 1667 4.25e1 SMART
IQ 1668 1694 1.03e2 SMART
IQ 1695 1717 2.33e-2 SMART
IQ 1718 1740 7.79e0 SMART
IQ 1741 1763 1.57e2 SMART
IQ 1768 1790 2.68e-2 SMART
IQ 1791 1813 5.83e-3 SMART
IQ 1814 1836 5.93e1 SMART
IQ 1841 1863 1.92e-3 SMART
IQ 1864 1886 3.79e-2 SMART
IQ 1914 1936 4.11e0 SMART
IQ 1937 1959 1.87e-1 SMART
IQ 1960 1982 6.27e1 SMART
IQ 1987 2009 8.25e-3 SMART
IQ 2010 2032 5.73e0 SMART
IQ 2060 2082 1.39e0 SMART
IQ 2083 2105 4.62e1 SMART
IQ 2133 2155 5.58e0 SMART
IQ 2156 2178 7.07e-2 SMART
IQ 2206 2228 1.18e-3 SMART
IQ 2229 2251 4.59e0 SMART
IQ 2278 2300 1.85e-5 SMART
IQ 2301 2323 8.13e-2 SMART
IQ 2342 2364 9.62e-4 SMART
IQ 2365 2387 4.12e-3 SMART
IQ 2415 2437 7.58e-2 SMART
IQ 2438 2460 2.6e0 SMART
IQ 2490 2512 1.68e-3 SMART
IQ 2513 2535 8.51e1 SMART
IQ 2560 2582 2.14e-1 SMART
IQ 2601 2623 8.46e0 SMART
IQ 2647 2669 1.15e1 SMART
IQ 2673 2695 1.95e-4 SMART
IQ 2696 2718 4.13e1 SMART
IQ 2723 2745 1.02e-2 SMART
IQ 2761 2783 3.14e2 SMART
IQ 2784 2806 1e1 SMART
IQ 2825 2847 2.43e0 SMART
IQ 2848 2870 4.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196272
Predicted Effect probably benign
Transcript: ENSMUST00000200083
SMART Domains Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952

low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 1.25e1 SMART
IQ 1337 1358 2.96e1 SMART
IQ 1382 1404 1.15e1 SMART
IQ 1408 1430 1.95e-4 SMART
IQ 1431 1453 4.13e1 SMART
IQ 1458 1480 1.02e-2 SMART
IQ 1496 1518 3.14e2 SMART
IQ 1519 1541 1e1 SMART
IQ 1560 1582 2.43e0 SMART
IQ 1583 1605 4.6e-1 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.6%
  • 10x: 94.3%
  • 20x: 86.4%
Validation Efficiency 98% (125/127)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,259 D133G possibly damaging Het
Abcb4 A C 5: 8,939,835 D796A probably damaging Het
Actg2 A T 6: 83,519,914 V147E probably damaging Het
Adamts13 A C 2: 26,986,989 T534P probably damaging Het
Ago1 T C 4: 126,443,166 T249A probably benign Het
Ahnak T A 19: 9,002,495 I381N probably damaging Het
Akap9 A G 5: 4,069,038 D3515G probably benign Het
Angptl3 T C 4: 99,034,469 V249A probably benign Het
Ank A G 15: 27,567,572 T294A possibly damaging Het
Ank1 A T 8: 23,104,809 H204L probably damaging Het
Apbb2 A G 5: 66,310,988 probably benign Het
Arhgap28 A T 17: 67,901,429 S15T probably benign Het
Atp1a4 T C 1: 172,234,987 E651G probably damaging Het
B3gnt2 A T 11: 22,836,860 F109L probably damaging Het
Bpifb4 T C 2: 153,959,683 F575L probably damaging Het
Calr C A 8: 84,843,031 K322N probably benign Het
Ccdc188 T C 16: 18,219,305 S247P possibly damaging Het
Cdr1 T A X: 61,185,302 D86V unknown Het
Cep97 C T 16: 55,925,058 V48I probably damaging Het
Chaf1b T A 16: 93,884,511 C6S probably damaging Het
Chd3 C T 11: 69,357,018 D920N probably damaging Het
Clk1 T C 1: 58,413,033 probably benign Het
Cntnap3 T A 13: 64,757,436 probably benign Het
Col12a1 T A 9: 79,600,011 probably null Het
Col17a1 G T 19: 47,671,362 probably benign Het
Coq7 T A 7: 118,529,717 I32F possibly damaging Het
Cox6a2 A T 7: 128,205,935 F59I probably damaging Het
Cpq A G 15: 33,594,151 D436G probably damaging Het
Ctso G A 3: 81,944,861 probably null Het
Cxadr A T 16: 78,334,948 H274L probably benign Het
Cyp2c40 A T 19: 39,778,051 C367S possibly damaging Het
Cyp2c70 T G 19: 40,160,671 M344L possibly damaging Het
Defa35 G A 8: 21,065,855 V77I probably benign Het
Dhx57 A G 17: 80,274,881 Y432H probably damaging Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah7a C G 1: 53,405,690 D3952H probably damaging Het
Dnah9 C A 11: 66,026,972 probably benign Het
Dstyk C A 1: 132,456,864 probably benign Het
Efcab2 T A 1: 178,475,904 probably benign Het
Ehbp1l1 T C 19: 5,720,570 E287G possibly damaging Het
Epgn A G 5: 91,032,214 T87A probably benign Het
Erc2 A C 14: 28,141,225 E803A probably damaging Het
Fam26d A G 10: 34,044,047 W75R probably damaging Het
Fer A G 17: 64,139,016 *454W probably null Het
Glyr1 T C 16: 5,031,972 D179G probably damaging Het
Gm12830 T A 4: 114,844,976 probably benign Het
Gm14085 A T 2: 122,517,553 T253S probably benign Het
Gm9922 C A 14: 101,729,693 probably benign Het
Gsta3 C T 1: 21,264,894 P200S possibly damaging Het
Hmgxb3 G A 18: 61,155,128 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il16 T C 7: 83,722,554 K15E probably damaging Het
Kcnip2 T A 19: 45,794,075 probably benign Het
Kdm4c T C 4: 74,345,567 V696A probably benign Het
Kdr A G 5: 75,946,927 probably benign Het
Klhl33 T G 14: 50,891,411 H787P probably damaging Het
Klk14 A T 7: 43,694,345 T159S probably benign Het
Lancl2 A G 6: 57,703,132 N16D probably damaging Het
Lemd3 T C 10: 120,937,110 N583S possibly damaging Het
Map3k4 TGCTGGCTTCAGGGCCACAGTCCGCTG TGCTG 17: 12,271,015 probably null Het
Mpl T G 4: 118,446,038 probably benign Het
Myh7b T C 2: 155,630,672 probably benign Het
Mylk A C 16: 34,912,297 probably benign Het
Myof A T 19: 37,981,266 M316K probably benign Het
Nfib T A 4: 82,296,737 N543I probably damaging Het
Nfix A G 8: 84,721,774 S375P probably damaging Het
Nkrf T C X: 36,890,116 Q171R probably damaging Het
Nmnat2 T A 1: 153,077,001 probably benign Het
Npffr2 G A 5: 89,583,347 E379K probably benign Het
Npr2 T C 4: 43,640,904 probably benign Het
Nup98 A C 7: 102,152,428 D212E probably null Het
Nwd2 T C 5: 63,807,218 Y1382H probably damaging Het
Ocstamp T C 2: 165,395,992 R451G possibly damaging Het
Olfr593 T A 7: 103,212,721 I287K probably damaging Het
Olfr804 A G 10: 129,705,139 D87G probably benign Het
Pabpc1 C T 15: 36,597,493 A551T possibly damaging Het
Papd7 A T 13: 69,499,932 V781E possibly damaging Het
Pard3 A T 8: 127,376,897 probably benign Het
Pcdhb12 G T 18: 37,436,121 V107L probably benign Het
Pik3cd A T 4: 149,663,220 V22D probably damaging Het
Pkd1l2 A G 8: 116,997,576 V2396A probably damaging Het
Pnpla7 T C 2: 24,987,195 I167T probably damaging Het
Pphln1 A T 15: 93,441,707 H114L possibly damaging Het
Ppm1h A G 10: 122,920,782 N444S probably damaging Het
Prdm9 G A 17: 15,557,384 T146I probably damaging Het
Prrc2a A G 17: 35,150,915 probably benign Het
Prrx1 T C 1: 163,312,559 D26G possibly damaging Het
Ptpn5 T C 7: 47,079,294 E495G probably damaging Het
Rab23 A C 1: 33,734,861 probably null Het
Ralgps1 C T 2: 33,157,923 M348I probably benign Het
Ranbp2 A G 10: 58,479,868 T2137A probably benign Het
Rapgef4 G T 2: 72,226,030 G654V probably benign Het
Rc3h2 A T 2: 37,379,008 probably benign Het
Reg2 G A 6: 78,406,186 A39T possibly damaging Het
Sema4d C A 13: 51,725,311 V7F probably benign Het
Sgip1 T C 4: 102,915,157 probably benign Het
Sgpl1 C T 10: 61,113,437 probably null Het
Shisa9 G A 16: 11,997,123 V212M probably damaging Het
Shq1 G A 6: 100,573,627 P450L probably benign Het
Sin3a A G 9: 57,110,912 T872A probably benign Het
Sipa1l3 C T 7: 29,348,350 R1371Q probably benign Het
Skint8 T C 4: 111,938,867 V246A probably benign Het
Slc22a20 A T 19: 5,972,957 V386D probably damaging Het
Slc2a7 G A 4: 150,158,071 probably benign Het
Slc35a2 T A X: 7,889,662 Y48N probably damaging Het
Slc4a2 G T 5: 24,434,346 S413I probably damaging Het
Sntg2 T C 12: 30,226,773 T427A probably benign Het
Soat1 T C 1: 156,442,453 Y132C probably damaging Het
Stn1 G T 19: 47,501,673 H342N probably benign Het
Tarbp1 T A 8: 126,438,928 probably benign Het
Tas2r113 A C 6: 132,893,378 K123T probably damaging Het
Tbck C T 3: 132,734,407 Q504* probably null Het
Tenm3 C T 8: 48,341,034 C380Y probably damaging Het
Triobp A G 15: 78,976,540 D1389G probably damaging Het
Trpm4 A T 7: 45,308,706 F780I probably damaging Het
Tubb4a G T 17: 57,081,182 Y281* probably null Het
Txndc15 T C 13: 55,724,582 F261S probably damaging Het
Ube3b T C 5: 114,419,469 probably benign Het
Unc5c G C 3: 141,733,933 V196L probably benign Het
Upf3a G A 8: 13,795,500 probably null Het
Vmn2r20 T C 6: 123,386,104 K574E probably benign Het
Vps50 A G 6: 3,536,853 M275V possibly damaging Het
Xrcc5 A G 1: 72,307,576 probably benign Het
Zbtb18 T C 1: 177,448,616 L505S probably damaging Het
Zbtb41 T C 1: 139,438,984 I567T probably damaging Het
Zfp598 T C 17: 24,678,584 probably benign Het
Other mutations in Aspm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Aspm APN 1 139478691 missense probably damaging 1.00
IGL00594:Aspm APN 1 139487422 splice site probably benign
IGL00808:Aspm APN 1 139461476 missense probably benign 0.03
IGL00897:Aspm APN 1 139477407 missense probably damaging 0.98
IGL01024:Aspm APN 1 139478124 missense possibly damaging 0.66
IGL01410:Aspm APN 1 139482444 missense probably benign 0.25
IGL01588:Aspm APN 1 139478162 missense probably benign 0.11
IGL01610:Aspm APN 1 139489670 nonsense probably null
IGL01633:Aspm APN 1 139480836 missense possibly damaging 0.93
IGL01982:Aspm APN 1 139491588 missense probably benign 0.12
IGL02429:Aspm APN 1 139479810 missense probably benign 0.27
IGL02468:Aspm APN 1 139480950 missense probably damaging 1.00
IGL02519:Aspm APN 1 139461927 splice site probably benign
IGL02526:Aspm APN 1 139489719 missense probably benign 0.03
IGL02716:Aspm APN 1 139479687 missense probably damaging 1.00
IGL02876:Aspm APN 1 139473653 missense probably damaging 1.00
IGL02953:Aspm APN 1 139457419 missense probably benign 0.01
IGL03275:Aspm APN 1 139487295 missense probably damaging 1.00
Stemware UTSW 1 139477459 nonsense probably null
3-1:Aspm UTSW 1 139457541 missense probably benign
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0140:Aspm UTSW 1 139480641 missense probably benign 0.00
R0195:Aspm UTSW 1 139479135 missense probably damaging 1.00
R0217:Aspm UTSW 1 139457880 missense possibly damaging 0.46
R0276:Aspm UTSW 1 139478471 missense possibly damaging 0.95
R0466:Aspm UTSW 1 139477901 missense probably damaging 1.00
R0520:Aspm UTSW 1 139478820 missense possibly damaging 0.51
R0615:Aspm UTSW 1 139487289 missense probably damaging 1.00
R0626:Aspm UTSW 1 139491601 missense probably damaging 1.00
R0660:Aspm UTSW 1 139457764 missense probably benign 0.03
R0751:Aspm UTSW 1 139456898 splice site probably benign
R0830:Aspm UTSW 1 139474254 missense probably damaging 0.99
R1109:Aspm UTSW 1 139456758 missense probably damaging 0.99
R1114:Aspm UTSW 1 139461924 splice site probably benign
R1130:Aspm UTSW 1 139477834 missense possibly damaging 0.90
R1298:Aspm UTSW 1 139457419 missense probably benign 0.01
R1386:Aspm UTSW 1 139457623 missense probably benign 0.03
R1386:Aspm UTSW 1 139478972 missense possibly damaging 0.80
R1557:Aspm UTSW 1 139468668 missense probably benign 0.01
R1625:Aspm UTSW 1 139481039 missense probably benign 0.01
R1728:Aspm UTSW 1 139473574 missense probably benign
R1729:Aspm UTSW 1 139473574 missense probably benign
R1730:Aspm UTSW 1 139473574 missense probably benign
R1733:Aspm UTSW 1 139457117 missense probably benign 0.27
R1739:Aspm UTSW 1 139473574 missense probably benign
R1762:Aspm UTSW 1 139473574 missense probably benign
R1783:Aspm UTSW 1 139473574 missense probably benign
R1784:Aspm UTSW 1 139473574 missense probably benign
R1785:Aspm UTSW 1 139473574 missense probably benign
R1793:Aspm UTSW 1 139457341 missense probably benign 0.00
R1893:Aspm UTSW 1 139479867 missense probably damaging 1.00
R1911:Aspm UTSW 1 139478094 missense probably benign 0.06
R2103:Aspm UTSW 1 139491665 missense probably damaging 0.99
R2128:Aspm UTSW 1 139457635 missense probably benign 0.14
R2129:Aspm UTSW 1 139457635 missense probably benign 0.14
R2239:Aspm UTSW 1 139456846 missense possibly damaging 0.67
R2352:Aspm UTSW 1 139457562 missense probably benign 0.02
R2353:Aspm UTSW 1 139477697 missense probably damaging 1.00
R2380:Aspm UTSW 1 139479348 missense probably damaging 1.00
R2413:Aspm UTSW 1 139477757 missense probably damaging 1.00
R2421:Aspm UTSW 1 139488487 missense possibly damaging 0.49
R3607:Aspm UTSW 1 139480668 missense probably benign 0.13
R3711:Aspm UTSW 1 139458100 missense probably benign 0.17
R3718:Aspm UTSW 1 139480889 missense probably benign 0.09
R3718:Aspm UTSW 1 139490427 missense probably benign 0.31
R3741:Aspm UTSW 1 139478619 missense possibly damaging 0.47
R3788:Aspm UTSW 1 139463203 missense probably damaging 1.00
R3838:Aspm UTSW 1 139478054 missense probably benign 0.24
R3839:Aspm UTSW 1 139478054 missense probably benign 0.24
R3849:Aspm UTSW 1 139458286 missense probably benign 0.21
R4075:Aspm UTSW 1 139474285 missense probably damaging 1.00
R4080:Aspm UTSW 1 139470755 missense probably damaging 1.00
R4463:Aspm UTSW 1 139455010 missense possibly damaging 0.95
R4537:Aspm UTSW 1 139474303 missense probably benign 0.01
R4547:Aspm UTSW 1 139478187 missense possibly damaging 0.75
R4573:Aspm UTSW 1 139479507 missense probably damaging 0.98
R4680:Aspm UTSW 1 139480671 missense probably benign 0.05
R4807:Aspm UTSW 1 139477919 missense probably damaging 1.00
R4840:Aspm UTSW 1 139470531 missense possibly damaging 0.83
R4854:Aspm UTSW 1 139478072 nonsense probably null
R4859:Aspm UTSW 1 139469393 missense probably damaging 1.00
R4893:Aspm UTSW 1 139489839 critical splice donor site probably null
R4910:Aspm UTSW 1 139491543 missense probably damaging 1.00
R4953:Aspm UTSW 1 139471734 missense probably benign 0.00
R4974:Aspm UTSW 1 139478010 missense probably benign 0.03
R4981:Aspm UTSW 1 139470760 splice site probably null
R5082:Aspm UTSW 1 139478676 nonsense probably null
R5223:Aspm UTSW 1 139478334 missense probably damaging 1.00
R5268:Aspm UTSW 1 139464295 missense probably damaging 1.00
R5371:Aspm UTSW 1 139470541 nonsense probably null
R5377:Aspm UTSW 1 139457483 missense probably damaging 0.96
R5377:Aspm UTSW 1 139470395 splice site probably null
R5481:Aspm UTSW 1 139457061 missense possibly damaging 0.85
R5513:Aspm UTSW 1 139482398 missense probably damaging 1.00
R5578:Aspm UTSW 1 139470717 missense probably damaging 1.00
R5649:Aspm UTSW 1 139479669 missense probably benign
R5685:Aspm UTSW 1 139487288 missense probably benign 0.10
R5695:Aspm UTSW 1 139479669 missense probably benign
R5766:Aspm UTSW 1 139479002 missense probably damaging 0.99
R5964:Aspm UTSW 1 139455227 intron probably benign
R5993:Aspm UTSW 1 139479531 missense probably benign 0.28
R6027:Aspm UTSW 1 139463056 missense probably damaging 1.00
R6029:Aspm UTSW 1 139480990 missense possibly damaging 0.83
R6102:Aspm UTSW 1 139477459 nonsense probably null
R6188:Aspm UTSW 1 139479239 missense possibly damaging 0.79
R6257:Aspm UTSW 1 139482053 splice site probably null
R6433:Aspm UTSW 1 139473683 missense probably damaging 1.00
R6682:Aspm UTSW 1 139457722 missense possibly damaging 0.67
R6763:Aspm UTSW 1 139470517 missense possibly damaging 0.64
R6798:Aspm UTSW 1 139468685 missense possibly damaging 0.66
R6815:Aspm UTSW 1 139480142 missense probably benign 0.04
R6854:Aspm UTSW 1 139463182 missense possibly damaging 0.90
R6928:Aspm UTSW 1 139480206 nonsense probably null
R6943:Aspm UTSW 1 139480542 missense probably damaging 1.00
R6979:Aspm UTSW 1 139480485 missense probably damaging 1.00
R6998:Aspm UTSW 1 139469472 missense probably damaging 1.00
R7126:Aspm UTSW 1 139480803 missense probably benign 0.27
R7237:Aspm UTSW 1 139477929 missense possibly damaging 0.81
R7240:Aspm UTSW 1 139478651 nonsense probably null
R7272:Aspm UTSW 1 139458328 missense probably benign 0.14
R7427:Aspm UTSW 1 139457616 missense probably benign 0.01
R7519:Aspm UTSW 1 139490336 missense possibly damaging 0.53
R7776:Aspm UTSW 1 139479846 missense possibly damaging 0.85
R7875:Aspm UTSW 1 139455134 missense probably benign 0.02
R7883:Aspm UTSW 1 139478667 missense possibly damaging 0.47
R7964:Aspm UTSW 1 139480686 missense probably damaging 1.00
R8012:Aspm UTSW 1 139457464 missense probably benign 0.03
R8029:Aspm UTSW 1 139471632 missense probably benign 0.00
R8233:Aspm UTSW 1 139457304 missense probably benign 0.28
R8277:Aspm UTSW 1 139455010 missense probably damaging 1.00
R8345:Aspm UTSW 1 139464273 nonsense probably null
R8491:Aspm UTSW 1 139457695 missense probably damaging 0.98
R8511:Aspm UTSW 1 139457308 missense probably damaging 1.00
R8557:Aspm UTSW 1 139456756 missense probably benign 0.01
R8927:Aspm UTSW 1 139490387 nonsense probably null
R8928:Aspm UTSW 1 139490387 nonsense probably null
R8950:Aspm UTSW 1 139478952 missense probably damaging 1.00
R9033:Aspm UTSW 1 139478127 missense probably damaging 1.00
R9083:Aspm UTSW 1 139493698 missense possibly damaging 0.70
R9133:Aspm UTSW 1 139491528 missense probably damaging 1.00
R9160:Aspm UTSW 1 139490124 missense probably damaging 1.00
R9179:Aspm UTSW 1 139476715 missense probably damaging 1.00
R9265:Aspm UTSW 1 139461444 missense probably benign 0.24
R9400:Aspm UTSW 1 139479903 missense probably damaging 1.00
R9419:Aspm UTSW 1 139457185 missense probably benign 0.29
R9454:Aspm UTSW 1 139480994 missense probably benign 0.00
X0063:Aspm UTSW 1 139458090 missense probably benign 0.01
Predicted Primers PCR Primer
(R):5'- CATACACAGACCACCCACagaaaagaaa -3'

Sequencing Primer
(R):5'- CACCCACagaaaagaaaagaaaag -3'
Posted On 2013-04-16