Mutagenetix > Incidental Mutations

Incidental Mutation 'R2698:Pdcd6ip'

251339

Institutional Source

Beutler Lab

Gene Symbol

Pdcd6ip

Ensembl Gene

ENSMUSG00000032504

Gene Name

programmed cell death 6 interacting protein

Synonyms

Alix, AIP1

MMRRC Submission

040436-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2698 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113651744-113708259 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 113674507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000107492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035086] [ENSMUST00000111861]

AlphaFold

Q9WU78

Predicted Effect

probably null
Transcript: ENSMUST00000035086

SMART Domains

Protein: ENSMUSP00000035086
Gene: ENSMUSG00000032504

Domain	Start	End	E-Value	Type
BRO1	3	382	1.99e-160	SMART
Pfam:ALIX_LYPXL_bnd	408	702	3.6e-91	PFAM
low complexity region	731	812	N/A	INTRINSIC
Blast:BRO1	813	839	2e-11	BLAST
low complexity region	840	869	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000111861

SMART Domains

Protein: ENSMUSP00000107492
Gene: ENSMUSG00000032504

Domain	Start	End	E-Value	Type
BRO1	3	387	3.46e-160	SMART
Pfam:ALIX_LYPXL_bnd	417	706	8.8e-96	PFAM
low complexity region	736	817	N/A	INTRINSIC
Blast:BRO1	818	844	2e-11	BLAST
low complexity region	845	874	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135545

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased body and brain size and exhibit structural defects in the epithelium of the choroid plexus and in the brain ependyma that culminate in excessive cell extrusion, enlargement of the lateral ventricles, and hydrocephalus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	G	13: 66,433,434	S59P	probably damaging	Het
Abcc9	T	C	6: 142,633,136	R901G	possibly damaging	Het
Abhd18	T	A	3: 40,930,966	M262K	probably benign	Het
Ano2	C	A	6: 125,712,346	L145I	probably benign	Het
Ckap5	T	C	2: 91,578,081	W874R	probably damaging	Het
Cox4i1	G	T	8: 120,669,363		probably benign	Het
Cwc27	A	T	13: 104,806,751	N94K	probably damaging	Het
Dcaf11	T	C	14: 55,566,885	S372P	probably damaging	Het
Dpysl4	A	G	7: 139,096,765	N356S	probably damaging	Het
Dusp8	A	G	7: 142,081,964		probably benign	Het
Erc2	G	A	14: 28,271,705	V894M	probably benign	Het
Fbxo28	T	A	1: 182,317,154	I282F	probably benign	Het
Fsd2	T	C	7: 81,545,860	T434A	probably damaging	Het
Gabra4	T	C	5: 71,572,078	H453R	probably benign	Het
Glrx	T	A	13: 75,839,946		probably null	Het
Gm11541	A	T	11: 94,695,615	L102*	probably null	Het
Gm5113	T	A	7: 30,178,725	Y79*	probably null	Het
Gpr87	T	A	3: 59,179,166	N306I	probably damaging	Het
Hydin	T	A	8: 110,609,929	Y5113N	possibly damaging	Het
Iqsec3	C	T	6: 121,413,471		probably benign	Het
Kbtbd8	C	A	6: 95,126,589	Y406*	probably null	Het
Lamb1	G	T	12: 31,298,883	R590L	probably benign	Het
Lin54	A	T	5: 100,480,250	N31K	probably damaging	Het
Lnpk	T	C	2: 74,537,501	E165G	probably damaging	Het
Lrp4	C	T	2: 91,475,212	R276C	probably damaging	Het
Lrrc7	T	A	3: 158,135,391	T1384S	probably benign	Het
Mia2	T	C	12: 59,170,994		probably null	Het
Morc2a	T	C	11: 3,685,400	V797A	probably damaging	Het
Mrps23	T	C	11: 88,205,367		probably benign	Het
Muc3	A	T	5: 137,146,636	I62K	probably damaging	Het
Nlrp4g	T	A	9: 124,349,630		noncoding transcript	Het
Nptx1	A	T	11: 119,544,843		probably benign	Het
Olfr352	T	A	2: 36,870,196	I210K	possibly damaging	Het
Pabpc1l	T	G	2: 164,044,382		probably null	Het
Plcg1	A	G	2: 160,761,463	T1185A	possibly damaging	Het
Plcxd1	A	G	5: 110,102,483	Q230R	probably benign	Het
Psme4	T	A	11: 30,874,282		probably null	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptch1	T	A	13: 63,542,224	N320Y	probably damaging	Het
Qars	G	A	9: 108,508,443	V60I	possibly damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rhag	T	C	17: 40,836,476	S410P	probably damaging	Het
Rnf213	A	G	11: 119,410,144	K297E	probably benign	Het
Rps6ka4	T	C	19: 6,837,352	E294G	probably benign	Het
Scaf4	T	A	16: 90,244,356	I695F	unknown	Het
Scrn2	T	C	11: 97,032,296		probably benign	Het
Scx	T	A	15: 76,458,163	C188S	probably damaging	Het
Sdk1	G	T	5: 142,212,050	V1893L	possibly damaging	Het
Sema5a	C	A	15: 32,673,400	Q795K	probably damaging	Het
Slc24a3	A	G	2: 145,613,567	S459G	probably benign	Het
Smurf1	A	G	5: 144,883,562		probably benign	Het
Taar4	T	C	10: 23,961,430	Y313H	probably damaging	Het
Tmprss11c	A	G	5: 86,271,463	F79S	probably damaging	Het
Tnfaip8l2	T	A	3: 95,140,361	I64F	possibly damaging	Het
Trbv13-1	A	G	6: 41,116,438	T102A	probably damaging	Het
Trpa1	A	T	1: 14,905,998	N160K	probably damaging	Het
Ttc22	A	G	4: 106,639,238	Y495C	probably benign	Het
Usp50	A	G	2: 126,778,029	I121T	probably damaging	Het
Vmn2r117	A	G	17: 23,459,911	S780P	probably damaging	Het
Vmn2r66	A	T	7: 84,995,399	V601D	probably damaging	Het
Wapl	G	A	14: 34,691,777	A199T	probably benign	Het
Zfp658	A	G	7: 43,573,545	T415A	possibly damaging	Het
Zfp760	C	T	17: 21,720,954	T9I	probably damaging	Het

Other mutations in Pdcd6ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Pdcd6ip	APN	9	113697518	missense	possibly damaging	0.89
IGL00814:Pdcd6ip	APN	9	113687653	missense	probably damaging	0.97
IGL01092:Pdcd6ip	APN	9	113680181	splice site	probably benign
IGL01621:Pdcd6ip	APN	9	113685422	missense	probably benign	0.03
IGL01781:Pdcd6ip	APN	9	113691498	missense	probably damaging	1.00
IGL02158:Pdcd6ip	APN	9	113680053	nonsense	probably null
IGL03136:Pdcd6ip	APN	9	113691499	missense	probably damaging	1.00
IGL03137:Pdcd6ip	APN	9	113657145	missense	possibly damaging	0.69
IGL03246:Pdcd6ip	APN	9	113678417	missense	possibly damaging	0.93
R0230:Pdcd6ip	UTSW	9	113685293	splice site	probably benign
R0284:Pdcd6ip	UTSW	9	113662504	missense	probably damaging	1.00
R0862:Pdcd6ip	UTSW	9	113674510	splice site	probably benign
R0864:Pdcd6ip	UTSW	9	113674510	splice site	probably benign
R1025:Pdcd6ip	UTSW	9	113662286	missense	probably damaging	1.00
R1687:Pdcd6ip	UTSW	9	113700019	missense	probably damaging	1.00
R1699:Pdcd6ip	UTSW	9	113678354	missense	probably damaging	1.00
R1957:Pdcd6ip	UTSW	9	113708022	missense	probably damaging	1.00
R2317:Pdcd6ip	UTSW	9	113672774	missense	probably benign	0.03
R4182:Pdcd6ip	UTSW	9	113700010	missense	probably benign	0.00
R5154:Pdcd6ip	UTSW	9	113691542	missense	probably damaging	1.00
R5229:Pdcd6ip	UTSW	9	113678333	missense	probably damaging	0.99
R5391:Pdcd6ip	UTSW	9	113691518	missense	probably damaging	1.00
R5972:Pdcd6ip	UTSW	9	113662298	missense	probably benign	0.07
R6149:Pdcd6ip	UTSW	9	113659871	missense	probably benign	0.03
R6406:Pdcd6ip	UTSW	9	113674344	missense	possibly damaging	0.81
R6514:Pdcd6ip	UTSW	9	113689694	missense	probably benign	0.43
R6869:Pdcd6ip	UTSW	9	113655106	missense	unknown
R6888:Pdcd6ip	UTSW	9	113671837	missense	probably benign	0.04
R7078:Pdcd6ip	UTSW	9	113659885	missense	probably benign	0.01
R7683:Pdcd6ip	UTSW	9	113687695	missense	probably damaging	1.00
R8260:Pdcd6ip	UTSW	9	113672797	missense	probably benign	0.05
R8376:Pdcd6ip	UTSW	9	113689616	missense	probably damaging	1.00
R8495:Pdcd6ip	UTSW	9	113689707	missense	probably benign	0.23
R8926:Pdcd6ip	UTSW	9	113685425	missense	probably benign	0.23
R9080:Pdcd6ip	UTSW	9	113691556	missense	probably damaging	0.96
R9260:Pdcd6ip	UTSW	9	113697504	critical splice donor site	probably null
R9315:Pdcd6ip	UTSW	9	113659853	missense	possibly damaging	0.50
Z1177:Pdcd6ip	UTSW	9	113685369	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GAGCACTCTTTTCAAGCATACCTC -3'
(R):5'- TGGGTGGATATAAGTGACTGCC -3'

Sequencing Primer
(F):5'- CAAGCATACCTCCTCTAATATTTCTC -3'
(R):5'- AACAGGATTTCTTTGTTTTAGCTCTG -3'

Posted On

2014-12-04