Incidental Mutation 'R0284:Pdcd6ip'
ID24617
Institutional Source Beutler Lab
Gene Symbol Pdcd6ip
Ensembl Gene ENSMUSG00000032504
Gene Nameprogrammed cell death 6 interacting protein
SynonymsAlix, AIP1
MMRRC Submission 038505-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0284 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location113651744-113708259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113662504 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 552 (L552S)
Ref Sequence ENSEMBL: ENSMUSP00000035086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035086] [ENSMUST00000111861]
Predicted Effect probably damaging
Transcript: ENSMUST00000035086
AA Change: L552S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035086
Gene: ENSMUSG00000032504
AA Change: L552S

DomainStartEndE-ValueType
BRO1 3 382 1.99e-160 SMART
Pfam:ALIX_LYPXL_bnd 408 702 3.6e-91 PFAM
low complexity region 731 812 N/A INTRINSIC
Blast:BRO1 813 839 2e-11 BLAST
low complexity region 840 869 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111861
AA Change: L557S

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107492
Gene: ENSMUSG00000032504
AA Change: L557S

DomainStartEndE-ValueType
BRO1 3 387 3.46e-160 SMART
Pfam:ALIX_LYPXL_bnd 417 706 8.8e-96 PFAM
low complexity region 736 817 N/A INTRINSIC
Blast:BRO1 818 844 2e-11 BLAST
low complexity region 845 874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137104
Meta Mutation Damage Score 0.8489 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.4%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased body and brain size and exhibit structural defects in the epithelium of the choroid plexus and in the brain ependyma that culminate in excessive cell extrusion, enlargement of the lateral ventricles, and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T G 4: 41,507,538 E150A probably damaging Het
Akap2 T C 4: 57,855,207 F220L probably damaging Het
Alkbh6 A G 7: 30,313,988 T161A probably benign Het
Alox12e A G 11: 70,320,899 probably benign Het
Ap1g2 A G 14: 55,101,692 probably benign Het
Arid2 A T 15: 96,378,967 probably benign Het
Bmp2k A T 5: 97,068,455 H604L unknown Het
Cacna1a A T 8: 84,612,285 M1705L probably damaging Het
Cacna1d A T 14: 30,072,105 D1526E probably damaging Het
Ccdc171 A G 4: 83,549,738 R107G possibly damaging Het
Cklf T C 8: 104,261,575 probably benign Het
Crabp1 A G 9: 54,764,926 K9E probably benign Het
Cspg4 A G 9: 56,886,139 D386G probably damaging Het
Cyp3a41b G A 5: 145,578,204 probably benign Het
Dsg1a T A 18: 20,331,627 V393E probably damaging Het
Ednrb C T 14: 103,820,013 G371D probably damaging Het
Efcab5 T C 11: 77,103,527 probably benign Het
Exoc2 A T 13: 30,877,625 probably benign Het
Fbn2 G A 18: 58,050,290 probably benign Het
Foxo6 T C 4: 120,269,002 S199G probably benign Het
Fpr1 T A 17: 17,877,356 I124F probably damaging Het
Gk5 A T 9: 96,181,770 probably null Het
Gys1 A T 7: 45,436,719 probably benign Het
Igfbp1 T C 11: 7,198,103 S49P probably damaging Het
Incenp A T 19: 9,893,993 S91T unknown Het
Itpkc G A 7: 27,214,543 R498* probably null Het
Kat6a A G 8: 22,939,803 T1725A unknown Het
Kiz T A 2: 146,863,810 C97S probably benign Het
Kri1 A G 9: 21,276,552 probably benign Het
Lipn A G 19: 34,080,706 S276G possibly damaging Het
Llgl1 A G 11: 60,712,141 T881A probably damaging Het
Man1a2 T C 3: 100,684,786 H26R probably damaging Het
Map3k5 T A 10: 20,000,613 F173I probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 A G 12: 57,457,069 Q341R probably damaging Het
Mllt6 G T 11: 97,678,605 A928S probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nipsnap3a C T 4: 52,997,178 T150I probably benign Het
Nsl1 A G 1: 191,065,230 E97G probably damaging Het
Olfr1278 T C 2: 111,292,586 V106A probably benign Het
Olfr251 G A 9: 38,378,584 M234I probably benign Het
Olfr736 G A 14: 50,392,995 V80M probably damaging Het
Olfr830 A T 9: 18,875,552 Y72F probably benign Het
Plekhf2 T C 4: 10,990,595 probably benign Het
Prdm1 T C 10: 44,456,626 E96G probably damaging Het
Prpf40a T A 2: 53,150,647 E608D probably damaging Het
Prpf40b A T 15: 99,316,393 probably benign Het
Rag2 T C 2: 101,630,119 V258A probably damaging Het
S100a5 A G 3: 90,611,574 I68V probably benign Het
Serpinb8 G A 1: 107,602,918 probably null Het
Slc24a4 T C 12: 102,260,481 V492A probably damaging Het
Spag6l T A 16: 16,780,766 Q287L probably damaging Het
Synpo2 C T 3: 123,079,734 W211* probably null Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Trerf1 A G 17: 47,319,545 noncoding transcript Het
Ttn G C 2: 76,846,704 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps13d A T 4: 145,144,802 M1900K probably benign Het
Vps41 A T 13: 18,853,440 D691V probably damaging Het
Zfp518b T C 5: 38,671,740 Y974C probably damaging Het
Zscan29 A T 2: 121,166,733 probably benign Het
Other mutations in Pdcd6ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pdcd6ip APN 9 113697518 missense possibly damaging 0.89
IGL00814:Pdcd6ip APN 9 113687653 missense probably damaging 0.97
IGL01092:Pdcd6ip APN 9 113680181 splice site probably benign
IGL01621:Pdcd6ip APN 9 113685422 missense probably benign 0.03
IGL01781:Pdcd6ip APN 9 113691498 missense probably damaging 1.00
IGL02158:Pdcd6ip APN 9 113680053 nonsense probably null
IGL03136:Pdcd6ip APN 9 113691499 missense probably damaging 1.00
IGL03137:Pdcd6ip APN 9 113657145 missense possibly damaging 0.69
IGL03246:Pdcd6ip APN 9 113678417 missense possibly damaging 0.93
R0230:Pdcd6ip UTSW 9 113685293 splice site probably benign
R0862:Pdcd6ip UTSW 9 113674510 splice site probably benign
R0864:Pdcd6ip UTSW 9 113674510 splice site probably benign
R1025:Pdcd6ip UTSW 9 113662286 missense probably damaging 1.00
R1687:Pdcd6ip UTSW 9 113700019 missense probably damaging 1.00
R1699:Pdcd6ip UTSW 9 113678354 missense probably damaging 1.00
R1957:Pdcd6ip UTSW 9 113708022 missense probably damaging 1.00
R2317:Pdcd6ip UTSW 9 113672774 missense probably benign 0.03
R2698:Pdcd6ip UTSW 9 113674507 splice site probably null
R4182:Pdcd6ip UTSW 9 113700010 missense probably benign 0.00
R5154:Pdcd6ip UTSW 9 113691542 missense probably damaging 1.00
R5229:Pdcd6ip UTSW 9 113678333 missense probably damaging 0.99
R5391:Pdcd6ip UTSW 9 113691518 missense probably damaging 1.00
R5972:Pdcd6ip UTSW 9 113662298 missense probably benign 0.07
R6149:Pdcd6ip UTSW 9 113659871 missense probably benign 0.03
R6406:Pdcd6ip UTSW 9 113674344 missense possibly damaging 0.81
R6514:Pdcd6ip UTSW 9 113689694 missense probably benign 0.43
R6869:Pdcd6ip UTSW 9 113655106 missense unknown
R6888:Pdcd6ip UTSW 9 113671837 missense probably benign 0.04
R7078:Pdcd6ip UTSW 9 113659885 missense probably benign 0.01
R7683:Pdcd6ip UTSW 9 113687695 missense probably damaging 1.00
R8260:Pdcd6ip UTSW 9 113672797 missense probably benign 0.05
R8376:Pdcd6ip UTSW 9 113689616 missense probably damaging 1.00
Z1177:Pdcd6ip UTSW 9 113685369 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAGACCGCCATAGATCCGATCCAG -3'
(R):5'- AGTAACAGTCCGTCATGTTGACTGC -3'

Sequencing Primer
(F):5'- TAGATCCGATCCAGCTCAGTG -3'
(R):5'- cccttcttccccttcttcttc -3'
Posted On2013-04-16