Incidental Mutation 'R2510:F11'
ID251974
Institutional Source Beutler Lab
Gene Symbol F11
Ensembl Gene ENSMUSG00000031645
Gene Namecoagulation factor XI
SynonymsFXI, plasma thromboplastin antecedent, Cf11, 1600027G01Rik
MMRRC Submission 040416-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2510 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45241174-45262031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45248638 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 353 (S353P)
Ref Sequence ENSEMBL: ENSMUSP00000034064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034064]
Predicted Effect probably damaging
Transcript: ENSMUST00000034064
AA Change: S353P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034064
Gene: ENSMUSG00000031645
AA Change: S353P

DomainStartEndE-ValueType
APPLE 20 103 2.89e-29 SMART
APPLE 110 193 1.02e-29 SMART
APPLE 200 283 2.29e-32 SMART
APPLE 291 376 1.04e-30 SMART
Tryp_SPc 389 617 1.54e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210622
Meta Mutation Damage Score 0.5090 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that can be activated by coagulation factor XIIa, thrombin or factor XIa to generate active factor XIa protease. Mice lacking the encoded protein display a survival advantage during peritoneal sepsis and resist inflammation and bacterial accumulation upon infection with Listeria. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show a tendency for slightly prolonged tail transection bleeding times and are protected from vessel-occluding fibrin formation after transient ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Adra1d C A 2: 131,562,135 E12* probably null Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Atxn2 C T 5: 121,781,393 S388L probably damaging Het
Bbox1 A T 2: 110,305,631 M1K probably null Het
Btaf1 G A 19: 37,002,445 R1538H probably benign Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Copb2 T A 9: 98,571,648 probably benign Het
Dnah2 G T 11: 69,524,206 S234* probably null Het
Dnah9 T C 11: 66,005,169 Y2460C probably damaging Het
Dnaic2 G C 11: 114,757,167 probably benign Het
Dst C A 1: 34,212,286 T1814K probably benign Het
Fancm A T 12: 65,113,770 probably benign Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5117 T A 8: 31,738,355 noncoding transcript Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Grm5 A G 7: 88,036,091 E472G probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Kansl2 A G 15: 98,528,861 probably null Het
Kat2a T C 11: 100,712,142 Q88R probably benign Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Llgl1 A G 11: 60,710,036 K653E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mafb T G 2: 160,366,576 E34A probably damaging Het
Meiob T C 17: 24,816,597 probably benign Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mprip T A 11: 59,749,508 probably benign Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Mycbp2 C T 14: 103,155,255 R3290Q probably damaging Het
Obscn G A 11: 59,042,314 probably benign Het
Olfm3 T A 3: 115,122,310 V277D probably damaging Het
Olfr1271 C T 2: 90,265,606 V275I probably damaging Het
Olfr1286 G A 2: 111,420,451 P167S possibly damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr960 T A 9: 39,623,431 F101I probably damaging Het
Omp A T 7: 98,145,345 M25K possibly damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pde12 T C 14: 26,665,526 *609W probably null Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Ppp1r37 T C 7: 19,532,432 K470E possibly damaging Het
Ptprd C A 4: 76,086,011 probably null Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rims2 T G 15: 39,585,652 S1217R probably damaging Het
Rorc C T 3: 94,389,120 T208I probably benign Het
Ryr3 C T 2: 112,675,904 E3458K probably benign Het
Scn5a A T 9: 119,533,685 V623E probably benign Het
Slc28a2 C T 2: 122,451,016 Q229* probably null Het
Slc35f3 C T 8: 126,298,706 probably benign Het
Spg11 T G 2: 122,075,310 I1285L probably benign Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Susd1 A T 4: 59,349,855 V527E possibly damaging Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Ttn T C 2: 76,740,992 D26519G probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn1r37 T C 6: 66,731,951 L150P probably damaging Het
Vmn2r52 G T 7: 10,170,868 A348E probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wdyhv1 C A 15: 58,153,624 A145D probably damaging Het
Ypel5 T C 17: 72,846,391 L30P probably damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in F11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:F11 APN 8 45250095 missense probably damaging 1.00
IGL02096:F11 APN 8 45246754 missense probably benign 0.05
IGL02363:F11 APN 8 45241531 missense probably damaging 1.00
IGL02694:F11 APN 8 45252159 missense probably damaging 1.00
IGL03374:F11 APN 8 45261074 missense possibly damaging 0.63
R0225:F11 UTSW 8 45249077 missense probably benign 0.00
R0525:F11 UTSW 8 45253049 missense probably benign 0.01
R0842:F11 UTSW 8 45252159 missense probably damaging 1.00
R0961:F11 UTSW 8 45241494 missense probably damaging 1.00
R1605:F11 UTSW 8 45241580 missense probably damaging 1.00
R2044:F11 UTSW 8 45252118 missense probably benign 0.03
R2113:F11 UTSW 8 45246832 missense probably benign 0.00
R2273:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2274:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2275:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2318:F11 UTSW 8 45248638 missense probably damaging 1.00
R2319:F11 UTSW 8 45248638 missense probably damaging 1.00
R2403:F11 UTSW 8 45248638 missense probably damaging 1.00
R2512:F11 UTSW 8 45261061 missense probably benign 0.01
R2893:F11 UTSW 8 45248638 missense probably damaging 1.00
R2894:F11 UTSW 8 45248638 missense probably damaging 1.00
R2910:F11 UTSW 8 45241449 makesense probably null
R3030:F11 UTSW 8 45248638 missense probably damaging 1.00
R3105:F11 UTSW 8 45245717 missense probably damaging 0.97
R3721:F11 UTSW 8 45248638 missense probably damaging 1.00
R3726:F11 UTSW 8 45248638 missense probably damaging 1.00
R3906:F11 UTSW 8 45248638 missense probably damaging 1.00
R3909:F11 UTSW 8 45248638 missense probably damaging 1.00
R4465:F11 UTSW 8 45241474 missense probably damaging 1.00
R4467:F11 UTSW 8 45241474 missense probably damaging 1.00
R4710:F11 UTSW 8 45250146 missense probably damaging 1.00
R4824:F11 UTSW 8 45255342 missense probably damaging 0.99
R4968:F11 UTSW 8 45245733 missense probably benign 0.19
R5225:F11 UTSW 8 45255304 missense probably benign 0.09
R5288:F11 UTSW 8 45246796 missense probably damaging 1.00
R5378:F11 UTSW 8 45252143 missense probably benign 0.19
R6155:F11 UTSW 8 45252082 missense probably damaging 1.00
R6213:F11 UTSW 8 45241500 missense probably damaging 1.00
R6615:F11 UTSW 8 45248774 missense probably benign
R6797:F11 UTSW 8 45253055 missense probably benign 0.02
R7147:F11 UTSW 8 45250146 missense probably damaging 1.00
R7683:F11 UTSW 8 45249508 missense probably damaging 0.97
R7688:F11 UTSW 8 45250090 missense probably damaging 1.00
R7720:F11 UTSW 8 45252090 missense possibly damaging 0.89
R8064:F11 UTSW 8 45245773 missense probably benign 0.01
U24488:F11 UTSW 8 45242312 missense probably benign 0.04
Z1088:F11 UTSW 8 45245772 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCTATGGTTGTTGTAGACTAGCCTC -3'
(R):5'- GAGAAGAGCTGGACATCGTC -3'

Sequencing Primer
(F):5'- ACTAGCCTCGTGTAGTAGACTAGC -3'
(R):5'- CATCGTCGATGTGAAAGGCC -3'
Posted On2014-12-04